diff options
Diffstat (limited to 'tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fasta/fasta-2.cs')
| -rw-r--r-- | tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fasta/fasta-2.cs | 210 |
1 files changed, 210 insertions, 0 deletions
diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fasta/fasta-2.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fasta/fasta-2.cs new file mode 100644 index 0000000000..3694e5de47 --- /dev/null +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fasta/fasta-2.cs @@ -0,0 +1,210 @@ +// Licensed to the .NET Foundation under one or more agreements. +// The .NET Foundation licenses this file to you under the MIT license. +// See the LICENSE file in the project root for more information. + +// Adapted from fasta C# .NET Core #2 program +// http://benchmarksgame.alioth.debian.org/u64q/program.php?test=fasta&lang=csharpcore&id=2 +// aka (as of 2017-09-01) rev 1.2 of https://alioth.debian.org/scm/viewvc.php/benchmarksgame/bench/fasta/fasta.csharp-2.csharp?root=benchmarksgame&view=log +// Best-scoring single-threaded C# .NET Core version as of 2017-09-01 + +/* The Computer Language Benchmarks Game + http://benchmarksgame.alioth.debian.org/ + + contributed by Isaac Gouy + optimizations by Alp Toker <alp@atoker.com> +*/ + +using System; +using System.IO; +using System.Text; +using Microsoft.Xunit.Performance; + +[assembly: OptimizeForBenchmarks] + +namespace BenchmarksGame +{ + public class Fasta_2 + { + static int Main(string[] args) + { + int n = args.Length > 0 ? Int32.Parse(args[0]) : 1000; + + Bench(n, true); + return 100; + } + + [Benchmark(InnerIterationCount = 2500)] + public static void RunBench() + { + Benchmark.Iterate(() => Bench(5000, false)); + } + + static void Bench(int n, bool verbose) + { + MakeCumulative(HomoSapiens); + MakeCumulative(IUB); + + using (Stream s = (verbose ? Console.OpenStandardOutput() : Stream.Null)) + { + MakeRepeatFasta("ONE", "Homo sapiens alu", Encoding.ASCII.GetBytes(ALU), n * 2, s); + MakeRandomFasta("TWO", "IUB ambiguity codes", IUB, n * 3, s); + MakeRandomFasta("THREE", "Homo sapiens frequency", HomoSapiens, n * 5, s); + } + } + + // The usual pseudo-random number generator + + const int IM = 139968; + const int IA = 3877; + const int IC = 29573; + static int seed = 42; + + static double random(double max) + { + return max * ((seed = (seed * IA + IC) % IM) * (1.0 / IM)); + } + + // Weighted selection from alphabet + + static string ALU = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; + + class Frequency + { + public byte c; + public double p; + + public Frequency(char c, double p) + { + this.c = (byte)c; + this.p = p; + } + } + + static Frequency[] IUB = { + new Frequency ('a', 0.27), + new Frequency ('c', 0.12), + new Frequency ('g', 0.12), + new Frequency ('t', 0.27), + + new Frequency ('B', 0.02), + new Frequency ('D', 0.02), + new Frequency ('H', 0.02), + new Frequency ('K', 0.02), + new Frequency ('M', 0.02), + new Frequency ('N', 0.02), + new Frequency ('R', 0.02), + new Frequency ('S', 0.02), + new Frequency ('V', 0.02), + new Frequency ('W', 0.02), + new Frequency ('Y', 0.02) + }; + + static Frequency[] HomoSapiens = { + new Frequency ('a', 0.3029549426680), + new Frequency ('c', 0.1979883004921), + new Frequency ('g', 0.1975473066391), + new Frequency ('t', 0.3015094502008) + }; + + static void MakeCumulative(Frequency[] a) + { + double cp = 0.0; + for (int i = 0; i < a.Length; i++) + { + cp += a[i].p; + a[i].p = cp; + } + } + + // naive + static byte SelectRandom(Frequency[] a) + { + double r = random(1.0); + + for (int i = 0; i < a.Length; i++) + if (r < a[i].p) + return a[i].c; + + return a[a.Length - 1].c; + } + + const int LineLength = 60; + static int index = 0; + static byte[] buf = new byte[1024]; + + static void MakeRandomFasta(string id, string desc, Frequency[] a, int n, Stream s) + { + index = 0; + int m = 0; + + byte[] descStr = Encoding.ASCII.GetBytes(">" + id + " " + desc + "\n"); + s.Write(descStr, 0, descStr.Length); + + while (n > 0) + { + m = n < LineLength ? n : LineLength; + + if (buf.Length - index < m) + { + s.Write(buf, 0, index); + index = 0; + } + + for (int i = 0; i < m; i++) + { + buf[index++] = SelectRandom(a); + } + + buf[index++] = (byte)'\n'; + n -= LineLength; + } + + if (index != 0) + s.Write(buf, 0, index); + } + + static void MakeRepeatFasta(string id, string desc, byte[] alu, int n, Stream s) + { + index = 0; + int m = 0; + int k = 0; + int kn = alu.Length; + + byte[] descStr = Encoding.ASCII.GetBytes(">" + id + " " + desc + "\n"); + s.Write(descStr, 0, descStr.Length); + + while (n > 0) + { + m = n < LineLength ? n : LineLength; + + if (buf.Length - index < m) + { + s.Write(buf, 0, index); + index = 0; + } + + for (int i = 0; i < m; i++) + { + if (k == kn) + k = 0; + + buf[index++] = alu[k]; + k++; + } + + buf[index++] = (byte)'\n'; + n -= LineLength; + } + + if (index != 0) + s.Write(buf, 0, index); + } + } +} |