diff options
author | Joseph Tremoulet <jotrem@microsoft.com> | 2017-09-14 14:56:50 -0400 |
---|---|---|
committer | Joseph Tremoulet <jotrem@microsoft.com> | 2017-09-15 13:28:10 -0400 |
commit | d0099ff43166d145e4899bb568ecc9e41aaa2d9a (patch) | |
tree | 29324a57ff537e7409c22824b1841bdf4d66dfec /tests/src/JIT/Performance | |
parent | 4d9e8b539f5e9518d707f55624d43309bae266a2 (diff) | |
download | coreclr-d0099ff43166d145e4899bb568ecc9e41aaa2d9a.tar.gz coreclr-d0099ff43166d145e4899bb568ecc9e41aaa2d9a.tar.bz2 coreclr-d0099ff43166d145e4899bb568ecc9e41aaa2d9a.zip |
Apply default VS formatting
Also insert namespace BenchmarksGame.
Diffstat (limited to 'tests/src/JIT/Performance')
18 files changed, 1755 insertions, 1583 deletions
diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/binarytrees/binarytrees-best.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/binarytrees/binarytrees-best.cs index f559a51081..7422274bc7 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/binarytrees/binarytrees-best.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/binarytrees/binarytrees-best.cs @@ -19,87 +19,94 @@ using System; using System.Runtime.CompilerServices; using System.Threading.Tasks; -public sealed class BinaryTrees +namespace BenchmarksGame { - public const int MinDepth = 4; - - public static void Main(string[] args) + public sealed class BinaryTrees { - var n = args.Length == 0 ? 0 : int.Parse(args[0]); - var maxDepth = n < (MinDepth + 2) ? MinDepth + 2 : n; - var stretchDepth = maxDepth + 1; + public const int MinDepth = 4; + + public static void Main(string[] args) + { + var n = args.Length == 0 ? 0 : int.Parse(args[0]); + var maxDepth = n < (MinDepth + 2) ? MinDepth + 2 : n; + var stretchDepth = maxDepth + 1; - var stretchDepthTask = Task.Run(() => TreeNode.CreateTree(stretchDepth).CountNodes()); - var maxDepthTask = Task.Run(() => TreeNode.CreateTree(maxDepth).CountNodes()); + var stretchDepthTask = Task.Run(() => TreeNode.CreateTree(stretchDepth).CountNodes()); + var maxDepthTask = Task.Run(() => TreeNode.CreateTree(maxDepth).CountNodes()); - var tasks = new Task<string>[(maxDepth - MinDepth) / 2 + 1]; - for (int depth = MinDepth, ti = 0; depth <= maxDepth; depth += 2, ti++) { - var iterationCount = 1 << (maxDepth - depth + MinDepth); - var depthCopy = depth; // To make sure closure value doesn't change - tasks[ti] = Task.Run(() => { - var count = 0; - if (depthCopy >= 17) { + var tasks = new Task<string>[(maxDepth - MinDepth) / 2 + 1]; + for (int depth = MinDepth, ti = 0; depth <= maxDepth; depth += 2, ti++) + { + var iterationCount = 1 << (maxDepth - depth + MinDepth); + var depthCopy = depth; // To make sure closure value doesn't change + tasks[ti] = Task.Run(() => + { + var count = 0; + if (depthCopy >= 17) + { // Parallelized computation for relatively large tasks var miniTasks = new Task<int>[iterationCount]; - for (var i = 0; i < iterationCount; i++) - miniTasks[i] = Task.Run(() => TreeNode.CreateTree(depthCopy).CountNodes()); - Task.WaitAll(miniTasks); - for (var i = 0; i < iterationCount; i++) - count += miniTasks[i].Result; - } - else { + for (var i = 0; i < iterationCount; i++) + miniTasks[i] = Task.Run(() => TreeNode.CreateTree(depthCopy).CountNodes()); + Task.WaitAll(miniTasks); + for (var i = 0; i < iterationCount; i++) + count += miniTasks[i].Result; + } + else + { // Sequential computation for smaller tasks for (var i = 0; i < iterationCount; i++) - count += TreeNode.CreateTree(depthCopy).CountNodes(); - } - return $"{iterationCount}\t trees of depth {depthCopy}\t check: {count}"; - }); - } - Task.WaitAll(tasks); + count += TreeNode.CreateTree(depthCopy).CountNodes(); + } + return $"{iterationCount}\t trees of depth {depthCopy}\t check: {count}"; + }); + } + Task.WaitAll(tasks); - Console.WriteLine("stretch tree of depth {0}\t check: {1}", - stretchDepth, stretchDepthTask.Result); - foreach (var task in tasks) - Console.WriteLine(task.Result); - Console.WriteLine("long lived tree of depth {0}\t check: {1}", - maxDepth, maxDepthTask.Result); + Console.WriteLine("stretch tree of depth {0}\t check: {1}", + stretchDepth, stretchDepthTask.Result); + foreach (var task in tasks) + Console.WriteLine(task.Result); + Console.WriteLine("long lived tree of depth {0}\t check: {1}", + maxDepth, maxDepthTask.Result); + } } -} -public struct TreeNode -{ - public sealed class NodeData + public struct TreeNode { - public TreeNode Left, Right; - - public NodeData(TreeNode left, TreeNode right) + public sealed class NodeData { - Left = left; - Right = right; + public TreeNode Left, Right; + + public NodeData(TreeNode left, TreeNode right) + { + Left = left; + Right = right; + } } - } - public NodeData Data; + public NodeData Data; - [MethodImpl(MethodImplOptions.AggressiveInlining)] - public TreeNode(TreeNode left, TreeNode right) - { - Data = new NodeData(left, right); - } + [MethodImpl(MethodImplOptions.AggressiveInlining)] + public TreeNode(TreeNode left, TreeNode right) + { + Data = new NodeData(left, right); + } - [MethodImpl(MethodImplOptions.AggressiveInlining)] - public static TreeNode CreateTree(int depth) - { - return depth <= 0 - ? default(TreeNode) - : new TreeNode(CreateTree(depth - 1), CreateTree(depth - 1)); - } + [MethodImpl(MethodImplOptions.AggressiveInlining)] + public static TreeNode CreateTree(int depth) + { + return depth <= 0 + ? default(TreeNode) + : new TreeNode(CreateTree(depth - 1), CreateTree(depth - 1)); + } - [MethodImpl(MethodImplOptions.AggressiveInlining)] - public int CountNodes() - { - if (ReferenceEquals(Data, null)) - return 1; - return 1 + Data.Left.CountNodes() + Data.Right.CountNodes(); + [MethodImpl(MethodImplOptions.AggressiveInlining)] + public int CountNodes() + { + if (ReferenceEquals(Data, null)) + return 1; + return 1 + Data.Left.CountNodes() + Data.Right.CountNodes(); + } } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/binarytrees/binarytrees-serial.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/binarytrees/binarytrees-serial.cs index 95732c6f33..6de000caea 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/binarytrees/binarytrees-serial.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/binarytrees/binarytrees-serial.cs @@ -15,72 +15,81 @@ using System; -class BinaryTrees +namespace BenchmarksGame { - const int minDepth = 4; - - public static void Main(String[] args) - { - int n = 0; - if (args.Length > 0) n = Int32.Parse(args[0]); - - int maxDepth = Math.Max(minDepth + 2, n); - int stretchDepth = maxDepth + 1; - - int check = (TreeNode.bottomUpTree(stretchDepth)).itemCheck(); - Console.WriteLine("stretch tree of depth {0}\t check: {1}", stretchDepth, check); - - TreeNode longLivedTree = TreeNode.bottomUpTree(maxDepth); - - for (int depth=minDepth; depth<=maxDepth; depth+=2){ - int iterations = 1 << (maxDepth - depth + minDepth); - - check = 0; - for (int i=1; i<=iterations; i++) - { - check += (TreeNode.bottomUpTree(depth)).itemCheck(); - } - - Console.WriteLine("{0}\t trees of depth {1}\t check: {2}", - iterations, depth, check); - } - - Console.WriteLine("long lived tree of depth {0}\t check: {1}", - maxDepth, longLivedTree.itemCheck()); - } - - - struct TreeNode - { - class Next - { - public TreeNode left, right; - } - - private Next next; - - internal static TreeNode bottomUpTree(int depth){ - if (depth>0){ - return new TreeNode( - bottomUpTree(depth-1) - , bottomUpTree(depth-1) - ); - } - else { - return new TreeNode(); - } - } - - TreeNode(TreeNode left, TreeNode right){ - this.next = new Next (); - this.next.left = left; - this.next.right = right; - } - - internal int itemCheck(){ - // if necessary deallocate here - if (next==null) return 1; - else return 1 + next.left.itemCheck() + next.right.itemCheck(); - } - } + class BinaryTrees + { + const int minDepth = 4; + + public static void Main(String[] args) + { + int n = 0; + if (args.Length > 0) n = Int32.Parse(args[0]); + + int maxDepth = Math.Max(minDepth + 2, n); + int stretchDepth = maxDepth + 1; + + int check = (TreeNode.bottomUpTree(stretchDepth)).itemCheck(); + Console.WriteLine("stretch tree of depth {0}\t check: {1}", stretchDepth, check); + + TreeNode longLivedTree = TreeNode.bottomUpTree(maxDepth); + + for (int depth = minDepth; depth <= maxDepth; depth += 2) + { + int iterations = 1 << (maxDepth - depth + minDepth); + + check = 0; + for (int i = 1; i <= iterations; i++) + { + check += (TreeNode.bottomUpTree(depth)).itemCheck(); + } + + Console.WriteLine("{0}\t trees of depth {1}\t check: {2}", + iterations, depth, check); + } + + Console.WriteLine("long lived tree of depth {0}\t check: {1}", + maxDepth, longLivedTree.itemCheck()); + } + + + struct TreeNode + { + class Next + { + public TreeNode left, right; + } + + private Next next; + + internal static TreeNode bottomUpTree(int depth) + { + if (depth > 0) + { + return new TreeNode( + bottomUpTree(depth - 1) + , bottomUpTree(depth - 1) + ); + } + else + { + return new TreeNode(); + } + } + + TreeNode(TreeNode left, TreeNode right) + { + this.next = new Next(); + this.next.left = left; + this.next.right = right; + } + + internal int itemCheck() + { + // if necessary deallocate here + if (next == null) return 1; + else return 1 + next.left.itemCheck() + next.right.itemCheck(); + } + } + } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fannkuch-redux/fannkuch-redux-best.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fannkuch-redux/fannkuch-redux-best.cs index 470b67beaf..c11f6a8cac 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fannkuch-redux/fannkuch-redux-best.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fannkuch-redux/fannkuch-redux-best.cs @@ -18,110 +18,113 @@ using System; using System.Threading; using System.Runtime.CompilerServices; -public static class FannkuchRedux +namespace BenchmarksGame { - static int[] fact, chkSums, maxFlips; - [MethodImpl(MethodImplOptions.AggressiveInlining)] - static void firstPermutation(int[] p, int[] pp, int[] count, int idx) + public static class FannkuchRedux { - for (int i = 0; i < p.Length; ++i) p[i] = i; - for (int i = count.Length - 1; i > 0; --i) + static int[] fact, chkSums, maxFlips; + [MethodImpl(MethodImplOptions.AggressiveInlining)] + static void firstPermutation(int[] p, int[] pp, int[] count, int idx) { - int d = idx / fact[i]; - count[i] = d; - if (d > 0) + for (int i = 0; i < p.Length; ++i) p[i] = i; + for (int i = count.Length - 1; i > 0; --i) { - idx = idx % fact[i]; - for (int j = i; j >= 0; --j) pp[j] = p[j]; - for (int j = 0; j <= i; ++j) p[j] = pp[(j + d) % (i + 1)]; + int d = idx / fact[i]; + count[i] = d; + if (d > 0) + { + idx = idx % fact[i]; + for (int j = i; j >= 0; --j) pp[j] = p[j]; + for (int j = 0; j <= i; ++j) p[j] = pp[(j + d) % (i + 1)]; + } } } - } - [MethodImpl(MethodImplOptions.AggressiveInlining)] - static int nextPermutation(int[] p, int[] count) - { - int first = p[1]; - p[1] = p[0]; - p[0] = first; - int i = 1; - while (++count[i] > i) + [MethodImpl(MethodImplOptions.AggressiveInlining)] + static int nextPermutation(int[] p, int[] count) { - count[i++] = 0; - int next = p[1]; - p[0] = next; - for (int j = 1; j < i;) p[j] = p[++j]; - p[i] = first; - first = next; + int first = p[1]; + p[1] = p[0]; + p[0] = first; + int i = 1; + while (++count[i] > i) + { + count[i++] = 0; + int next = p[1]; + p[0] = next; + for (int j = 1; j < i;) p[j] = p[++j]; + p[i] = first; + first = next; + } + return first; } - return first; - } - [MethodImpl(MethodImplOptions.AggressiveInlining)] - static int countFlips(int first, int[] p, int[] pp) - { - if (first == 0) return 0; - if (p[first] == 0) return 1; - for (int i = 0; i < pp.Length; i++) pp[i] = p[i]; - int flips = 2; - while (true) + [MethodImpl(MethodImplOptions.AggressiveInlining)] + static int countFlips(int first, int[] p, int[] pp) { - for (int lo = 1, hi = first - 1; lo < hi; lo++, hi--) + if (first == 0) return 0; + if (p[first] == 0) return 1; + for (int i = 0; i < pp.Length; i++) pp[i] = p[i]; + int flips = 2; + while (true) { - int t = pp[lo]; - pp[lo] = pp[hi]; - pp[hi] = t; + for (int lo = 1, hi = first - 1; lo < hi; lo++, hi--) + { + int t = pp[lo]; + pp[lo] = pp[hi]; + pp[hi] = t; + } + int tp = pp[first]; + if (pp[tp] == 0) return flips; + pp[first] = first; + first = tp; + flips++; } - int tp = pp[first]; - if (pp[tp] == 0) return flips; - pp[first] = first; - first = tp; - flips++; } - } - static void run(int n, int taskId, int taskSize) - { - int[] p = new int[n], pp = new int[n], count = new int[n]; - firstPermutation(p, pp, count, taskId * taskSize); - int chksum = countFlips(p[0], p, pp); - int maxflips = chksum; - while (--taskSize > 0) + static void run(int n, int taskId, int taskSize) { - var flips = countFlips(nextPermutation(p, count), p, pp); - chksum += (1 - (taskSize % 2) * 2) * flips; - if (flips > maxflips) maxflips = flips; + int[] p = new int[n], pp = new int[n], count = new int[n]; + firstPermutation(p, pp, count, taskId * taskSize); + int chksum = countFlips(p[0], p, pp); + int maxflips = chksum; + while (--taskSize > 0) + { + var flips = countFlips(nextPermutation(p, count), p, pp); + chksum += (1 - (taskSize % 2) * 2) * flips; + if (flips > maxflips) maxflips = flips; + } + chkSums[taskId] = chksum; + maxFlips[taskId] = maxflips; } - chkSums[taskId] = chksum; - maxFlips[taskId] = maxflips; - } - - public static void Main(string[] args) - { - int n = args.Length > 0 ? int.Parse(args[0]) : 7; - fact = new int[n + 1]; - fact[0] = 1; - var factn = 1; - for (int i = 1; i < fact.Length; i++) { fact[i] = factn *= i; } - int nTasks = Environment.ProcessorCount; - chkSums = new int[nTasks]; - maxFlips = new int[nTasks]; - int taskSize = factn / nTasks; - var threads = new Thread[nTasks]; - for (int i = 1; i < nTasks; i++) - { - int j = i; - (threads[j] = new Thread(() => run(n, j, taskSize))).Start(); - } - run(n, 0, taskSize); - int chksum = chkSums[0], maxflips = maxFlips[0]; - for (int i = 1; i < threads.Length; i++) + public static void Main(string[] args) { - threads[i].Join(); - chksum += chkSums[i]; - if (maxFlips[i] > maxflips) maxflips = maxFlips[i]; + int n = args.Length > 0 ? int.Parse(args[0]) : 7; + fact = new int[n + 1]; + fact[0] = 1; + var factn = 1; + for (int i = 1; i < fact.Length; i++) { fact[i] = factn *= i; } + + int nTasks = Environment.ProcessorCount; + chkSums = new int[nTasks]; + maxFlips = new int[nTasks]; + int taskSize = factn / nTasks; + var threads = new Thread[nTasks]; + for (int i = 1; i < nTasks; i++) + { + int j = i; + (threads[j] = new Thread(() => run(n, j, taskSize))).Start(); + } + run(n, 0, taskSize); + int chksum = chkSums[0], maxflips = maxFlips[0]; + for (int i = 1; i < threads.Length; i++) + { + threads[i].Join(); + chksum += chkSums[i]; + if (maxFlips[i] > maxflips) maxflips = maxFlips[i]; + } + Console.Out.WriteLineAsync(chksum + "\nPfannkuchen(" + n + ") = " + maxflips); } - Console.Out.WriteLineAsync(chksum + "\nPfannkuchen(" + n + ") = " + maxflips); } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fannkuch-redux/fannkuch-redux-serial.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fannkuch-redux/fannkuch-redux-serial.cs index 646b68d2b4..8c3f37d950 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fannkuch-redux/fannkuch-redux-serial.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fannkuch-redux/fannkuch-redux-serial.cs @@ -14,53 +14,68 @@ using System; -class FannkuchRedux +namespace BenchmarksGame { - public static int[] fannkuch(int n) { - int[] p = new int[n], q = new int[n], s = new int[n]; - int sign = 1, maxflips = 0, sum = 0, m = n-1; - for(int i=0; i<n; i++){ p[i] = i; q[i] = i; s[i] = i; } - do { - // Copy and flip. - var q0 = p[0]; // Cache 0th element. - if (q0 != 0){ - for(int i=1; i<n; i++) q[i] = p[i]; // Work on a copy. - var flips = 1; - do { - var qq = q[q0]; - if (qq == 0){ // ... until 0th element is 0. - sum += sign*flips; - if (flips > maxflips) maxflips = flips; // New maximum? - break; - } - q[q0] = q0; - if (q0 >= 3){ - int i = 1, j = q0 - 1, t; - do { t = q[i]; q[i] = q[j]; q[j] = t; i++; j--; } while (i < j); - } - q0 = qq; flips++; - } while (true); - } - // Permute. - if (sign == 1){ - var t = p[1]; p[1] = p[0]; p[0] = t; sign = -1; // Rotate 0<-1. - } else { - var t = p[1]; p[1] = p[2]; p[2] = t; sign = 1; // Rotate 0<-1 and 0<-1<-2. - for(int i=2; i<n; i++){ - var sx = s[i]; - if (sx != 0){ s[i] = sx-1; break; } - if (i == m) return new int[]{sum,maxflips}; // Out of permutations. - s[i] = i; - // Rotate 0<-...<-i+1. - t = p[0]; for(int j=0; j<=i; j++){ p[j] = p[j+1]; } p[i+1] = t; - } - } - } while (true); - } + class FannkuchRedux + { + public static int[] fannkuch(int n) + { + int[] p = new int[n], q = new int[n], s = new int[n]; + int sign = 1, maxflips = 0, sum = 0, m = n - 1; + for (int i = 0; i < n; i++) { p[i] = i; q[i] = i; s[i] = i; } + do + { + // Copy and flip. + var q0 = p[0]; // Cache 0th element. + if (q0 != 0) + { + for (int i = 1; i < n; i++) q[i] = p[i]; // Work on a copy. + var flips = 1; + do + { + var qq = q[q0]; + if (qq == 0) + { // ... until 0th element is 0. + sum += sign * flips; + if (flips > maxflips) maxflips = flips; // New maximum? + break; + } + q[q0] = q0; + if (q0 >= 3) + { + int i = 1, j = q0 - 1, t; + do { t = q[i]; q[i] = q[j]; q[j] = t; i++; j--; } while (i < j); + } + q0 = qq; flips++; + } while (true); + } + // Permute. + if (sign == 1) + { + var t = p[1]; p[1] = p[0]; p[0] = t; sign = -1; // Rotate 0<-1. + } + else + { + var t = p[1]; p[1] = p[2]; p[2] = t; sign = 1; // Rotate 0<-1 and 0<-1<-2. + for (int i = 2; i < n; i++) + { + var sx = s[i]; + if (sx != 0) { s[i] = sx - 1; break; } + if (i == m) return new int[] { sum, maxflips }; // Out of permutations. + s[i] = i; + // Rotate 0<-...<-i+1. + t = p[0]; for (int j = 0; j <= i; j++) { p[j] = p[j + 1]; } + p[i + 1] = t; + } + } + } while (true); + } - static void Main(string[] args){ - int n = (args.Length > 0) ? Int32.Parse(args[0]) : 7; - var pf = fannkuch(n); - Console.Write("{0}\nPfannkuchen({1}) = {2}\n", pf[0], n, pf[1]); - } + static void Main(string[] args) + { + int n = (args.Length > 0) ? Int32.Parse(args[0]) : 7; + var pf = fannkuch(n); + Console.Write("{0}\nPfannkuchen({1}) = {2}\n", pf[0], n, pf[1]); + } + } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fasta/fasta-best.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fasta/fasta-best.cs index 3430c37a6b..9c3d1eb137 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fasta/fasta-best.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fasta/fasta-best.cs @@ -24,231 +24,233 @@ using System.Text; using System.Threading; using System.Threading.Tasks; -class Fasta +namespace BenchmarksGame { - const int LineLength = 60; - - const int IM = 139968; - const int IA = 3877; - const int IC = 29573; - static int seed = 42; - - public static void Main(string[] args) + class Fasta { - int n = args.Length > 0 ? Int32.Parse(args[0]) : 1000; + const int LineLength = 60; - MakeCumulative(IUB); - MakeCumulative(HomoSapiens); + const int IM = 139968; + const int IA = 3877; + const int IC = 29573; + static int seed = 42; - using (var s = Console.OpenStandardOutput()) + public static void Main(string[] args) { - MakeRepeatFasta("ONE", "Homo sapiens alu", Encoding.ASCII.GetBytes(ALU), n * 2, s); - MakeRandomFasta("TWO", "IUB ambiguity codes", IUB, n * 3, s); - MakeRandomFasta("THREE", "Homo sapiens frequency", HomoSapiens, n * 5, s); - } - } + int n = args.Length > 0 ? Int32.Parse(args[0]) : 1000; + + MakeCumulative(IUB); + MakeCumulative(HomoSapiens); + using (var s = Console.OpenStandardOutput()) + { + MakeRepeatFasta("ONE", "Homo sapiens alu", Encoding.ASCII.GetBytes(ALU), n * 2, s); + MakeRandomFasta("TWO", "IUB ambiguity codes", IUB, n * 3, s); + MakeRandomFasta("THREE", "Homo sapiens frequency", HomoSapiens, n * 5, s); + } + } - public static IEnumerable<R> TransformQueue<T, R>(BlockingCollection<T> queue, - Func<T, R> transform, int threadCount) - { - var tasks = new Task<R>[threadCount]; - for (int i = 0; i < threadCount; ++i) + public static IEnumerable<R> TransformQueue<T, R>(BlockingCollection<T> queue, + Func<T, R> transform, int threadCount) { - T input; - if (!queue.TryTake(out input, Timeout.Infinite)) - break; + var tasks = new Task<R>[threadCount]; - tasks[i] = Task.Run(() => transform(input)); - } + for (int i = 0; i < threadCount; ++i) + { + T input; + if (!queue.TryTake(out input, Timeout.Infinite)) + break; - int pos = 0; - while (true) - { - if (tasks[pos] == null) - break; + tasks[i] = Task.Run(() => transform(input)); + } + + int pos = 0; + while (true) + { + if (tasks[pos] == null) + break; - yield return tasks[pos].Result; + yield return tasks[pos].Result; - T input; - tasks[pos] = queue.TryTake(out input, Timeout.Infinite) - ? Task.Run(() => transform(input)) - : null; + T input; + tasks[pos] = queue.TryTake(out input, Timeout.Infinite) + ? Task.Run(() => transform(input)) + : null; - pos = (pos + 1) % threadCount; + pos = (pos + 1) % threadCount; + } } - } - static void MakeRandomFasta(string id, string desc, - Frequency[] a, int n, Stream s) - { - var queue = new BlockingCollection<int[]>(2); + static void MakeRandomFasta(string id, string desc, + Frequency[] a, int n, Stream s) + { + var queue = new BlockingCollection<int[]>(2); - var bufferCount = Environment.ProcessorCount + 4; + var bufferCount = Environment.ProcessorCount + 4; - Task.Run(() => - { - var len = LineLength * 40; - var buffers = Enumerable.Range(0, bufferCount) - .Select(i => new int[len]).ToArray(); - var index = 0; - for (var i = 0; i < n; i += len) + Task.Run(() => { - var buffer = n - i < len - ? new int[n - i] - : buffers[index++ % buffers.Length]; - - FillRandom(buffer); - queue.Add(buffer); + var len = LineLength * 40; + var buffers = Enumerable.Range(0, bufferCount) + .Select(i => new int[len]).ToArray(); + var index = 0; + for (var i = 0; i < n; i += len) + { + var buffer = n - i < len + ? new int[n - i] + : buffers[index++ % buffers.Length]; + + FillRandom(buffer); + queue.Add(buffer); + } + queue.CompleteAdding(); + }); + + byte[] descStr = Encoding.ASCII.GetBytes(">" + id + " " + desc + "\n"); + s.Write(descStr, 0, descStr.Length); + + foreach (var r in TransformQueue(queue, + rnd => SelectNucleotides(a, rnd), Environment.ProcessorCount)) + { + s.Write(r, 0, r.Length); } - queue.CompleteAdding(); - }); - byte[] descStr = Encoding.ASCII.GetBytes(">" + id + " " + desc + "\n"); - s.Write(descStr, 0, descStr.Length); - - foreach (var r in TransformQueue(queue, - rnd => SelectNucleotides(a, rnd), Environment.ProcessorCount)) - { - s.Write(r, 0, r.Length); } - } - - private static byte[] SelectNucleotides(Frequency[] a, int[] rnd) - { - var resLength = (rnd.Length / LineLength) * (LineLength + 1); - if (rnd.Length % LineLength != 0) + private static byte[] SelectNucleotides(Frequency[] a, int[] rnd) { - resLength += rnd.Length % LineLength + 1; - } + var resLength = (rnd.Length / LineLength) * (LineLength + 1); + if (rnd.Length % LineLength != 0) + { + resLength += rnd.Length % LineLength + 1; + } - var buf = new byte[resLength]; - var index = 0; - for (var i = 0; i < rnd.Length; i += LineLength) - { - var len = Math.Min(LineLength, rnd.Length - i); - for (var j = 0; j < len; ++j) - buf[index++] = SelectRandom(a, (int)rnd[i + j]); - buf[index++] = (byte)'\n'; + var buf = new byte[resLength]; + var index = 0; + for (var i = 0; i < rnd.Length; i += LineLength) + { + var len = Math.Min(LineLength, rnd.Length - i); + for (var j = 0; j < len; ++j) + buf[index++] = SelectRandom(a, (int)rnd[i + j]); + buf[index++] = (byte)'\n'; + } + return buf; } - return buf; - } - static void MakeRepeatFasta(string id, string desc, - byte[] alu, int n, Stream s) - { - byte[] descStr = Encoding.ASCII.GetBytes(">" + id + " " + desc + "\n"); - s.Write(descStr, 0, descStr.Length); + static void MakeRepeatFasta(string id, string desc, + byte[] alu, int n, Stream s) + { + byte[] descStr = Encoding.ASCII.GetBytes(">" + id + " " + desc + "\n"); + s.Write(descStr, 0, descStr.Length); - /* JG: fasta_repeat repeats every len(alu) * line-length = 287 * 61 = 17507 characters. - So, calculate this once, then just print that buffer over and over. */ + /* JG: fasta_repeat repeats every len(alu) * line-length = 287 * 61 = 17507 characters. + So, calculate this once, then just print that buffer over and over. */ - byte[] sequence; - int sequenceLength; - using (var unstandardOut = new MemoryStream(alu.Length * (LineLength + 1) + 1)) - { - MakeRepeatFastaBuffer(alu, alu.Length * LineLength, unstandardOut); - sequenceLength = (int)unstandardOut.Length; - sequence = new byte[sequenceLength]; - unstandardOut.Seek(0, SeekOrigin.Begin); - unstandardOut.Read(sequence, 0, sequenceLength); - } - int outputBytes = n + n / 60; - while (outputBytes >= sequenceLength) - { - s.Write(sequence, 0, sequenceLength); - outputBytes -= sequenceLength; - } - if (outputBytes > 0) - { - s.Write(sequence, 0, outputBytes); - s.WriteByte((byte)'\n'); + byte[] sequence; + int sequenceLength; + using (var unstandardOut = new MemoryStream(alu.Length * (LineLength + 1) + 1)) + { + MakeRepeatFastaBuffer(alu, alu.Length * LineLength, unstandardOut); + sequenceLength = (int)unstandardOut.Length; + sequence = new byte[sequenceLength]; + unstandardOut.Seek(0, SeekOrigin.Begin); + unstandardOut.Read(sequence, 0, sequenceLength); + } + int outputBytes = n + n / 60; + while (outputBytes >= sequenceLength) + { + s.Write(sequence, 0, sequenceLength); + outputBytes -= sequenceLength; + } + if (outputBytes > 0) + { + s.Write(sequence, 0, outputBytes); + s.WriteByte((byte)'\n'); + } } - } - - static void MakeRepeatFastaBuffer(byte[] alu, int n, Stream s) - { - var index = 0; - int m = 0; - int k = 0; - int kn = alu.Length; - var buf = new byte[1024]; - while (n > 0) + static void MakeRepeatFastaBuffer(byte[] alu, int n, Stream s) { - m = n < LineLength ? n : LineLength; + var index = 0; + int m = 0; + int k = 0; + int kn = alu.Length; + var buf = new byte[1024]; - if (buf.Length - index < m) + while (n > 0) { - s.Write(buf, 0, index); - index = 0; - } + m = n < LineLength ? n : LineLength; - for (int i = 0; i < m; i++) - { - if (k == kn) - k = 0; + if (buf.Length - index < m) + { + s.Write(buf, 0, index); + index = 0; + } + + for (int i = 0; i < m; i++) + { + if (k == kn) + k = 0; - buf[index++] = alu[k]; - k++; + buf[index++] = alu[k]; + k++; + } + + buf[index++] = (byte)'\n'; + n -= LineLength; } - buf[index++] = (byte)'\n'; - n -= LineLength; + if (index != 0) + s.Write(buf, 0, index); } - if (index != 0) - s.Write(buf, 0, index); - } - - [MethodImpl(MethodImplOptions.AggressiveInlining)] - static byte SelectRandom(Frequency[] a, int r) - { - for (int i = 0; i < a.Length - 1; i++) - if (r < a[i].p) - return a[i].c; + [MethodImpl(MethodImplOptions.AggressiveInlining)] + static byte SelectRandom(Frequency[] a, int r) + { + for (int i = 0; i < a.Length - 1; i++) + if (r < a[i].p) + return a[i].c; - return a[a.Length - 1].c; - } + return a[a.Length - 1].c; + } - static void MakeCumulative(Frequency[] a) - { - double cp = 0; - for (int i = 0; i < a.Length; i++) + static void MakeCumulative(Frequency[] a) { - cp += a[i].p; - a[i].p = cp; + double cp = 0; + for (int i = 0; i < a.Length; i++) + { + cp += a[i].p; + a[i].p = cp; + } } - } - static string ALU = - "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + - "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + - "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + - "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + - "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + - "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + - "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; + static string ALU = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; - struct Frequency - { - public readonly byte c; - public double p; - - public Frequency(char c, double p) + struct Frequency { - this.c = (byte)c; - this.p = (p * IM); + public readonly byte c; + public double p; + + public Frequency(char c, double p) + { + this.c = (byte)c; + this.p = (p * IM); + } } - } - static Frequency[] IUB = { + static Frequency[] IUB = { new Frequency ('a', 0.27) ,new Frequency ('c', 0.12) ,new Frequency ('g', 0.12) @@ -267,7 +269,7 @@ class Fasta ,new Frequency ('Y', 0.02) }; - static Frequency[] HomoSapiens = { + static Frequency[] HomoSapiens = { new Frequency ('a', 0.3029549426680) ,new Frequency ('c', 0.1979883004921) ,new Frequency ('g', 0.1975473066391) @@ -275,14 +277,15 @@ class Fasta }; - private static void FillRandom(int[] result) - { - var s = seed; - for (var i = 0; i < result.Length; i++) + private static void FillRandom(int[] result) { - s = (s * IA + IC) % IM; - result[i] = s; + var s = seed; + for (var i = 0; i < result.Length; i++) + { + s = (s * IA + IC) % IM; + result[i] = s; + } + seed = s; } - seed = s; } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fasta/fasta-serial.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fasta/fasta-serial.cs index e91c6f8dff..aa5fc0704f 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fasta/fasta-serial.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/fasta/fasta-serial.cs @@ -17,160 +17,178 @@ using System; using System.IO; using System.Text; -class Fasta +namespace BenchmarksGame { - static void Main (string[] args) { - MakeCumulative (HomoSapiens); - MakeCumulative (IUB); - - int n = args.Length > 0 ? Int32.Parse (args[0]) : 1000; - - using (Stream s = Console.OpenStandardOutput ()) { - MakeRepeatFasta ("ONE", "Homo sapiens alu", Encoding.ASCII.GetBytes (ALU), n*2, s); - MakeRandomFasta ("TWO", "IUB ambiguity codes", IUB, n*3, s); - MakeRandomFasta ("THREE", "Homo sapiens frequency", HomoSapiens, n*5, s); - } - } - - // The usual pseudo-random number generator - - const int IM = 139968; - const int IA = 3877; - const int IC = 29573; - static int seed = 42; - - static double random (double max) - { - return max * ((seed = (seed * IA + IC) % IM) * (1.0 / IM)); - } - - // Weighted selection from alphabet - - static string ALU = - "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + - "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + - "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + - "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + - "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + - "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + - "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; - - class Frequency { - public byte c; - public double p; - - public Frequency (char c, double p) { - this.c = (byte)c; - this.p = p; - } - } - - static Frequency[] IUB = { - new Frequency ('a', 0.27) - ,new Frequency ('c', 0.12) - ,new Frequency ('g', 0.12) - ,new Frequency ('t', 0.27) - - ,new Frequency ('B', 0.02) - ,new Frequency ('D', 0.02) - ,new Frequency ('H', 0.02) - ,new Frequency ('K', 0.02) - ,new Frequency ('M', 0.02) - ,new Frequency ('N', 0.02) - ,new Frequency ('R', 0.02) - ,new Frequency ('S', 0.02) - ,new Frequency ('V', 0.02) - ,new Frequency ('W', 0.02) - ,new Frequency ('Y', 0.02) - }; - - static Frequency[] HomoSapiens = { - new Frequency ('a', 0.3029549426680) - ,new Frequency ('c', 0.1979883004921) - ,new Frequency ('g', 0.1975473066391) - ,new Frequency ('t', 0.3015094502008) - }; - - static void MakeCumulative (Frequency[] a) { - double cp = 0.0; - for (int i=0; i < a.Length; i++) { - cp += a[i].p; - a[i].p = cp; - } - } - - // naive - static byte SelectRandom (Frequency[] a) { - double r = random (1.0); - - for (int i=0 ; i < a.Length ; i++) - if (r < a[i].p) - return a[i].c; - - return a[a.Length-1].c; - } - - const int LineLength = 60; - static int index = 0; - static byte[] buf = new byte[1024]; - - static void MakeRandomFasta (string id, string desc, Frequency[] a, int n, Stream s) { - index = 0; - int m = 0; - - byte[] descStr = Encoding.ASCII.GetBytes (">" + id + " " + desc + "\n"); - s.Write (descStr, 0, descStr.Length); - - while (n > 0) { - m = n < LineLength ? n : LineLength; - - if (buf.Length - index < m) { - s.Write (buf, 0, index); - index = 0; - } - - for (int i = 0 ; i < m ; i++) { - buf[index++] = SelectRandom (a); - } - - buf[index++] = (byte)'\n'; - n -= LineLength; - } - - if (index != 0) - s.Write (buf, 0, index); - } - - static void MakeRepeatFasta (string id, string desc, byte[] alu, int n, Stream s) { - index = 0; - int m = 0; - int k = 0; - int kn = alu.Length; - - byte[] descStr = Encoding.ASCII.GetBytes (">" + id + " " + desc + "\n"); - s.Write (descStr, 0, descStr.Length); - - while (n > 0) { - m = n < LineLength ? n : LineLength; - - if (buf.Length - index < m) { - s.Write (buf, 0, index); - index = 0; - } - - for (int i = 0; i < m ; i++) { - if (k == kn) - k = 0; - - buf[index++] = alu[k]; - k++; - } - - buf[index++] = (byte)'\n'; - n -= LineLength; - } - - if (index != 0) - s.Write (buf, 0, index); - } + class Fasta + { + static void Main(string[] args) + { + MakeCumulative(HomoSapiens); + MakeCumulative(IUB); + + int n = args.Length > 0 ? Int32.Parse(args[0]) : 1000; + + using (Stream s = Console.OpenStandardOutput()) + { + MakeRepeatFasta("ONE", "Homo sapiens alu", Encoding.ASCII.GetBytes(ALU), n * 2, s); + MakeRandomFasta("TWO", "IUB ambiguity codes", IUB, n * 3, s); + MakeRandomFasta("THREE", "Homo sapiens frequency", HomoSapiens, n * 5, s); + } + } + + // The usual pseudo-random number generator + + const int IM = 139968; + const int IA = 3877; + const int IC = 29573; + static int seed = 42; + + static double random(double max) + { + return max * ((seed = (seed * IA + IC) % IM) * (1.0 / IM)); + } + + // Weighted selection from alphabet + + static string ALU = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; + + class Frequency + { + public byte c; + public double p; + + public Frequency(char c, double p) + { + this.c = (byte)c; + this.p = p; + } + } + + static Frequency[] IUB = { + new Frequency ('a', 0.27) + ,new Frequency ('c', 0.12) + ,new Frequency ('g', 0.12) + ,new Frequency ('t', 0.27) + + ,new Frequency ('B', 0.02) + ,new Frequency ('D', 0.02) + ,new Frequency ('H', 0.02) + ,new Frequency ('K', 0.02) + ,new Frequency ('M', 0.02) + ,new Frequency ('N', 0.02) + ,new Frequency ('R', 0.02) + ,new Frequency ('S', 0.02) + ,new Frequency ('V', 0.02) + ,new Frequency ('W', 0.02) + ,new Frequency ('Y', 0.02) + }; + + static Frequency[] HomoSapiens = { + new Frequency ('a', 0.3029549426680) + ,new Frequency ('c', 0.1979883004921) + ,new Frequency ('g', 0.1975473066391) + ,new Frequency ('t', 0.3015094502008) + }; + + static void MakeCumulative(Frequency[] a) + { + double cp = 0.0; + for (int i = 0; i < a.Length; i++) + { + cp += a[i].p; + a[i].p = cp; + } + } + + // naive + static byte SelectRandom(Frequency[] a) + { + double r = random(1.0); + + for (int i = 0; i < a.Length; i++) + if (r < a[i].p) + return a[i].c; + + return a[a.Length - 1].c; + } + + const int LineLength = 60; + static int index = 0; + static byte[] buf = new byte[1024]; + + static void MakeRandomFasta(string id, string desc, Frequency[] a, int n, Stream s) + { + index = 0; + int m = 0; + + byte[] descStr = Encoding.ASCII.GetBytes(">" + id + " " + desc + "\n"); + s.Write(descStr, 0, descStr.Length); + + while (n > 0) + { + m = n < LineLength ? n : LineLength; + + if (buf.Length - index < m) + { + s.Write(buf, 0, index); + index = 0; + } + + for (int i = 0; i < m; i++) + { + buf[index++] = SelectRandom(a); + } + + buf[index++] = (byte)'\n'; + n -= LineLength; + } + + if (index != 0) + s.Write(buf, 0, index); + } + + static void MakeRepeatFasta(string id, string desc, byte[] alu, int n, Stream s) + { + index = 0; + int m = 0; + int k = 0; + int kn = alu.Length; + + byte[] descStr = Encoding.ASCII.GetBytes(">" + id + " " + desc + "\n"); + s.Write(descStr, 0, descStr.Length); + + while (n > 0) + { + m = n < LineLength ? n : LineLength; + + if (buf.Length - index < m) + { + s.Write(buf, 0, index); + index = 0; + } + + for (int i = 0; i < m; i++) + { + if (k == kn) + k = 0; + + buf[index++] = alu[k]; + k++; + } + + buf[index++] = (byte)'\n'; + n -= LineLength; + } + + if (index != 0) + s.Write(buf, 0, index); + } + } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/k-nucleotide/k-nucleotide-best.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/k-nucleotide/k-nucleotide-best.cs index 2b648ddd56..990417d311 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/k-nucleotide/k-nucleotide-best.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/k-nucleotide/k-nucleotide-best.cs @@ -21,262 +21,266 @@ using System.Collections.Generic; using System.Threading.Tasks; using System.Runtime.CompilerServices; -class Wrapper { public int v=1; } -public static class KNucleotide +namespace BenchmarksGame { - const int BLOCK_SIZE = 1024 * 1024 * 8; - static List<byte[]> threeBlocks = new List<byte[]>(); - static int threeStart, threeEnd; - static byte[] tonum = new byte[256]; - static char[] tochar = new char[] {'A', 'C', 'G', 'T'}; - - static int read(Stream stream, byte[] buffer, int offset, int count) - { - var bytesRead = stream.Read(buffer, offset, count); - return bytesRead==count ? offset+count - : bytesRead==0 ? offset - : read(stream, buffer, offset+bytesRead, count-bytesRead); - } - - static int find(byte[] buffer, byte[] toFind, int i, ref int matchIndex) + class Wrapper { public int v = 1; } + public static class KNucleotide { - if(matchIndex==0) + const int BLOCK_SIZE = 1024 * 1024 * 8; + static List<byte[]> threeBlocks = new List<byte[]>(); + static int threeStart, threeEnd; + static byte[] tonum = new byte[256]; + static char[] tochar = new char[] { 'A', 'C', 'G', 'T' }; + + static int read(Stream stream, byte[] buffer, int offset, int count) { - i = Array.IndexOf(buffer, toFind[0], i); - if(i==-1) return -1; - matchIndex = 1; - return find(buffer, toFind, i+1, ref matchIndex); + var bytesRead = stream.Read(buffer, offset, count); + return bytesRead == count ? offset + count + : bytesRead == 0 ? offset + : read(stream, buffer, offset + bytesRead, count - bytesRead); } - else + + static int find(byte[] buffer, byte[] toFind, int i, ref int matchIndex) { - int bl = buffer.Length, fl = toFind.Length; - while(i<bl && matchIndex<fl) + if (matchIndex == 0) { - if(buffer[i++]!=toFind[matchIndex++]) + i = Array.IndexOf(buffer, toFind[0], i); + if (i == -1) return -1; + matchIndex = 1; + return find(buffer, toFind, i + 1, ref matchIndex); + } + else + { + int bl = buffer.Length, fl = toFind.Length; + while (i < bl && matchIndex < fl) { - matchIndex = 0; - return find(buffer, toFind, i, ref matchIndex); + if (buffer[i++] != toFind[matchIndex++]) + { + matchIndex = 0; + return find(buffer, toFind, i, ref matchIndex); + } } + return matchIndex == fl ? i : -1; } - return matchIndex==fl ? i : -1; } - } - static void loadThreeData() - { - var stream = Console.OpenStandardInput(); - - // find three sequence - int matchIndex = 0; - var toFind = new [] {(byte)'>', (byte)'T', (byte)'H', (byte)'R', (byte)'E', (byte)'E'}; - var buffer = new byte[BLOCK_SIZE]; - do + static void loadThreeData() { - threeEnd = read(stream, buffer, 0, BLOCK_SIZE); - threeStart = find(buffer, toFind, 0, ref matchIndex); - } while (threeStart==-1); - - // Skip to end of line - matchIndex = 0; - toFind = new [] {(byte)'\n'}; - threeStart = find(buffer, toFind, threeStart, ref matchIndex); - while(threeStart==-1) - { - threeEnd = read(stream, buffer, 0, BLOCK_SIZE); - threeStart = find(buffer, toFind, 0, ref matchIndex); - } - threeBlocks.Add(buffer); - - if(threeEnd!=BLOCK_SIZE) // Needs to be at least 2 blocks - { - var bytes = threeBlocks[0]; - for(int i=threeEnd; i<bytes.Length; i++) - bytes[i] = 255; - threeEnd = 0; - threeBlocks.Add(Array.Empty<byte>()); - return; - } + var stream = Console.OpenStandardInput(); - // find next seq or end of input - matchIndex = 0; - toFind = new [] {(byte)'>'}; - threeEnd = find(buffer, toFind, threeStart, ref matchIndex); - while(threeEnd==-1) - { - buffer = new byte[BLOCK_SIZE]; - var bytesRead = read(stream, buffer, 0, BLOCK_SIZE); - threeEnd = bytesRead==BLOCK_SIZE ? find(buffer, toFind, 0, ref matchIndex) - : bytesRead; + // find three sequence + int matchIndex = 0; + var toFind = new[] { (byte)'>', (byte)'T', (byte)'H', (byte)'R', (byte)'E', (byte)'E' }; + var buffer = new byte[BLOCK_SIZE]; + do + { + threeEnd = read(stream, buffer, 0, BLOCK_SIZE); + threeStart = find(buffer, toFind, 0, ref matchIndex); + } while (threeStart == -1); + + // Skip to end of line + matchIndex = 0; + toFind = new[] { (byte)'\n' }; + threeStart = find(buffer, toFind, threeStart, ref matchIndex); + while (threeStart == -1) + { + threeEnd = read(stream, buffer, 0, BLOCK_SIZE); + threeStart = find(buffer, toFind, 0, ref matchIndex); + } threeBlocks.Add(buffer); - } - if(threeStart+18>BLOCK_SIZE) // Key needs to be in the first block - { - byte[] block0 = threeBlocks[0], block1 = threeBlocks[1]; - Buffer.BlockCopy(block0, threeStart, block0, threeStart-18, BLOCK_SIZE-threeStart); - Buffer.BlockCopy(block1, 0, block0, BLOCK_SIZE-18, 18); - for(int i=0; i<18; i++) block1[i] = 255; - } - } + if (threeEnd != BLOCK_SIZE) // Needs to be at least 2 blocks + { + var bytes = threeBlocks[0]; + for (int i = threeEnd; i < bytes.Length; i++) + bytes[i] = 255; + threeEnd = 0; + threeBlocks.Add(Array.Empty<byte>()); + return; + } - [MethodImpl(MethodImplOptions.AggressiveInlining)] - static void check(Dictionary<long, Wrapper> dict, ref long rollingKey, byte nb, long mask) - { - if(nb==255) return; - rollingKey = ((rollingKey & mask) << 2) | nb; - Wrapper w; - if (dict.TryGetValue(rollingKey, out w)) - w.v++; - else - dict[rollingKey] = new Wrapper(); - } + // find next seq or end of input + matchIndex = 0; + toFind = new[] { (byte)'>' }; + threeEnd = find(buffer, toFind, threeStart, ref matchIndex); + while (threeEnd == -1) + { + buffer = new byte[BLOCK_SIZE]; + var bytesRead = read(stream, buffer, 0, BLOCK_SIZE); + threeEnd = bytesRead == BLOCK_SIZE ? find(buffer, toFind, 0, ref matchIndex) + : bytesRead; + threeBlocks.Add(buffer); + } - [MethodImpl(MethodImplOptions.AggressiveInlining)] - static void checkEnding(Dictionary<long, Wrapper> dict, ref long rollingKey, byte b, byte nb, long mask) - { - if(nb==b) + if (threeStart + 18 > BLOCK_SIZE) // Key needs to be in the first block + { + byte[] block0 = threeBlocks[0], block1 = threeBlocks[1]; + Buffer.BlockCopy(block0, threeStart, block0, threeStart - 18, BLOCK_SIZE - threeStart); + Buffer.BlockCopy(block1, 0, block0, BLOCK_SIZE - 18, 18); + for (int i = 0; i < 18; i++) block1[i] = 255; + } + } + + [MethodImpl(MethodImplOptions.AggressiveInlining)] + static void check(Dictionary<long, Wrapper> dict, ref long rollingKey, byte nb, long mask) { + if (nb == 255) return; + rollingKey = ((rollingKey & mask) << 2) | nb; Wrapper w; if (dict.TryGetValue(rollingKey, out w)) w.v++; else dict[rollingKey] = new Wrapper(); - rollingKey = ((rollingKey << 2) | nb) & mask; } - else if(nb!=255) + + [MethodImpl(MethodImplOptions.AggressiveInlining)] + static void checkEnding(Dictionary<long, Wrapper> dict, ref long rollingKey, byte b, byte nb, long mask) { - rollingKey = ((rollingKey << 2) | nb) & mask; + if (nb == b) + { + Wrapper w; + if (dict.TryGetValue(rollingKey, out w)) + w.v++; + else + dict[rollingKey] = new Wrapper(); + rollingKey = ((rollingKey << 2) | nb) & mask; + } + else if (nb != 255) + { + rollingKey = ((rollingKey << 2) | nb) & mask; + } } - } - static Task<string> count(int l, long mask, Func<Dictionary<long,Wrapper>,string> summary) - { - return Task.Run(() => + static Task<string> count(int l, long mask, Func<Dictionary<long, Wrapper>, string> summary) + { + return Task.Run(() => + { + long rollingKey = 0; + var firstBlock = threeBlocks[0]; + var start = threeStart; + while (--l > 0) rollingKey = (rollingKey << 2) | firstBlock[start++]; + var dict = new Dictionary<long, Wrapper>(); + for (int i = start; i < firstBlock.Length; i++) + check(dict, ref rollingKey, firstBlock[i], mask); + + int lastBlockId = threeBlocks.Count - 1; + for (int bl = 1; bl < lastBlockId; bl++) + { + var bytes = threeBlocks[bl]; + for (int i = 0; i < bytes.Length; i++) + check(dict, ref rollingKey, bytes[i], mask); + } + + var lastBlock = threeBlocks[lastBlockId]; + for (int i = 0; i < threeEnd; i++) + check(dict, ref rollingKey, lastBlock[i], mask); + return summary(dict); + }); + } + + static Dictionary<long, Wrapper> countEnding(int l, long mask, byte b) { long rollingKey = 0; var firstBlock = threeBlocks[0]; var start = threeStart; - while(--l>0) rollingKey = (rollingKey<<2) | firstBlock[start++]; - var dict = new Dictionary<long,Wrapper>(); - for(int i=start; i<firstBlock.Length; i++) - check(dict, ref rollingKey, firstBlock[i], mask); + while (--l > 0) rollingKey = (rollingKey << 2) | firstBlock[start++]; + var dict = new Dictionary<long, Wrapper>(); + for (int i = start; i < firstBlock.Length; i++) + checkEnding(dict, ref rollingKey, b, firstBlock[i], mask); - int lastBlockId = threeBlocks.Count-1; - for(int bl=1; bl<lastBlockId; bl++) + int lastBlockId = threeBlocks.Count - 1; + for (int bl = 1; bl < lastBlockId; bl++) { var bytes = threeBlocks[bl]; - for(int i=0; i<bytes.Length; i++) - check(dict, ref rollingKey, bytes[i], mask); + for (int i = 0; i < bytes.Length; i++) + checkEnding(dict, ref rollingKey, b, bytes[i], mask); } var lastBlock = threeBlocks[lastBlockId]; - for(int i=0; i<threeEnd; i++) - check(dict, ref rollingKey, lastBlock[i], mask); - return summary(dict); - }); - } - - static Dictionary<long,Wrapper> countEnding(int l, long mask, byte b) - { - long rollingKey = 0; - var firstBlock = threeBlocks[0]; - var start = threeStart; - while(--l>0) rollingKey = (rollingKey<<2) | firstBlock[start++]; - var dict = new Dictionary<long,Wrapper>(); - for(int i=start; i<firstBlock.Length; i++) - checkEnding(dict, ref rollingKey, b, firstBlock[i], mask); - - int lastBlockId = threeBlocks.Count-1; - for(int bl=1; bl<lastBlockId; bl++) - { - var bytes = threeBlocks[bl]; - for(int i=0; i<bytes.Length; i++) - checkEnding(dict, ref rollingKey, b, bytes[i], mask); + for (int i = 0; i < threeEnd; i++) + checkEnding(dict, ref rollingKey, b, lastBlock[i], mask); + return dict; } - var lastBlock = threeBlocks[lastBlockId]; - for(int i=0; i<threeEnd; i++) - checkEnding(dict, ref rollingKey, b, lastBlock[i], mask); - return dict; - } - - static Task<string> count4(int l, long mask, Func<Dictionary<long,Wrapper>,string> summary) - { - return Task.Factory.ContinueWhenAll( - new [] { + static Task<string> count4(int l, long mask, Func<Dictionary<long, Wrapper>, string> summary) + { + return Task.Factory.ContinueWhenAll( + new[] { Task.Run(() => countEnding(l, mask, 0)), Task.Run(() => countEnding(l, mask, 1)), Task.Run(() => countEnding(l, mask, 2)), Task.Run(() => countEnding(l, mask, 3)) - } - , dicts => { - var d = new Dictionary<long,Wrapper>(dicts.Sum(i => i.Result.Count)); - for(int i=0; i<dicts.Length; i++) - foreach(var kv in dicts[i].Result) - d[(kv.Key << 2) | (long)i] = kv.Value; - return summary(d); - }); - } + } + , dicts => + { + var d = new Dictionary<long, Wrapper>(dicts.Sum(i => i.Result.Count)); + for (int i = 0; i < dicts.Length; i++) + foreach (var kv in dicts[i].Result) + d[(kv.Key << 2) | (long)i] = kv.Value; + return summary(d); + }); + } - static string writeFrequencies(Dictionary<long,Wrapper> freq, int fragmentLength) - { - var sb = new StringBuilder(); - double percent = 100.0 / freq.Values.Sum(i => i.v); - foreach(var kv in freq.OrderByDescending(i => i.Value.v)) + static string writeFrequencies(Dictionary<long, Wrapper> freq, int fragmentLength) { - var keyChars = new char[fragmentLength]; - var key = kv.Key; - for (int i=keyChars.Length-1; i>=0; --i) + var sb = new StringBuilder(); + double percent = 100.0 / freq.Values.Sum(i => i.v); + foreach (var kv in freq.OrderByDescending(i => i.Value.v)) { - keyChars[i] = tochar[key & 0x3]; - key >>= 2; + var keyChars = new char[fragmentLength]; + var key = kv.Key; + for (int i = keyChars.Length - 1; i >= 0; --i) + { + keyChars[i] = tochar[key & 0x3]; + key >>= 2; + } + sb.Append(keyChars); + sb.Append(" "); + sb.AppendLine((kv.Value.v * percent).ToString("F3")); } - sb.Append(keyChars); - sb.Append(" "); - sb.AppendLine((kv.Value.v * percent).ToString("F3")); + return sb.ToString(); } - return sb.ToString(); - } - static string writeCount(Dictionary<long,Wrapper> dictionary, string fragment) - { - long key = 0; - for (int i=0; i<fragment.Length; ++i) - key = (key << 2) | tonum[fragment[i]]; - Wrapper w; - var n = dictionary.TryGetValue(key, out w) ? w.v : 0; - return string.Concat(n.ToString(), "\t", fragment); - } + static string writeCount(Dictionary<long, Wrapper> dictionary, string fragment) + { + long key = 0; + for (int i = 0; i < fragment.Length; ++i) + key = (key << 2) | tonum[fragment[i]]; + Wrapper w; + var n = dictionary.TryGetValue(key, out w) ? w.v : 0; + return string.Concat(n.ToString(), "\t", fragment); + } - public static void Main(string[] args) - { - tonum['c'] = 1; tonum['C'] = 1; - tonum['g'] = 2; tonum['G'] = 2; - tonum['t'] = 3; tonum['T'] = 3; - tonum['\n'] = 255; tonum['>'] = 255; tonum[255] = 255; + public static void Main(string[] args) + { + tonum['c'] = 1; tonum['C'] = 1; + tonum['g'] = 2; tonum['G'] = 2; + tonum['t'] = 3; tonum['T'] = 3; + tonum['\n'] = 255; tonum['>'] = 255; tonum[255] = 255; - loadThreeData(); + loadThreeData(); - Parallel.ForEach(threeBlocks, bytes => - { - for(int i=0; i<bytes.Length; i++) - bytes[i] = tonum[bytes[i]]; - }); + Parallel.ForEach(threeBlocks, bytes => + { + for (int i = 0; i < bytes.Length; i++) + bytes[i] = tonum[bytes[i]]; + }); - var task18 = count4(18, 34359738367, d => writeCount(d, "GGTATTTTAATTTATAGT")); - var task12 = count4(12, 8388607, d => writeCount(d, "GGTATTTTAATT")); - var task6 = count(6, 0b1111111111, d => writeCount(d, "GGTATT")); - var task4 = count(4, 0b111111, d => writeCount(d, "GGTA")); - var task3 = count(3, 0b1111, d => writeCount(d, "GGT")); - var task2 = count(2, 0b11, d => writeFrequencies(d, 2)); - var task1 = count(1, 0, d => writeFrequencies(d, 1)); + var task18 = count4(18, 34359738367, d => writeCount(d, "GGTATTTTAATTTATAGT")); + var task12 = count4(12, 8388607, d => writeCount(d, "GGTATTTTAATT")); + var task6 = count(6, 0b1111111111, d => writeCount(d, "GGTATT")); + var task4 = count(4, 0b111111, d => writeCount(d, "GGTA")); + var task3 = count(3, 0b1111, d => writeCount(d, "GGT")); + var task2 = count(2, 0b11, d => writeFrequencies(d, 2)); + var task1 = count(1, 0, d => writeFrequencies(d, 1)); - Console.Out.WriteLineAsync(task1.Result); - Console.Out.WriteLineAsync(task2.Result); - Console.Out.WriteLineAsync(task3.Result); - Console.Out.WriteLineAsync(task4.Result); - Console.Out.WriteLineAsync(task6.Result); - Console.Out.WriteLineAsync(task12.Result); - Console.Out.WriteLineAsync(task18.Result); + Console.Out.WriteLineAsync(task1.Result); + Console.Out.WriteLineAsync(task2.Result); + Console.Out.WriteLineAsync(task3.Result); + Console.Out.WriteLineAsync(task4.Result); + Console.Out.WriteLineAsync(task6.Result); + Console.Out.WriteLineAsync(task12.Result); + Console.Out.WriteLineAsync(task18.Result); + } } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/k-nucleotide/k-nucleotide-serial.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/k-nucleotide/k-nucleotide-serial.cs index b5add5fe00..8123e02720 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/k-nucleotide/k-nucleotide-serial.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/k-nucleotide/k-nucleotide-serial.cs @@ -17,149 +17,163 @@ using System.IO; using System.Collections.Generic; using System.Text; -public struct ByteString : IEquatable<ByteString> +namespace BenchmarksGame { - public byte[] Array; - public int Start; - public int Length; - - public ByteString(byte[] array, int start, int length) - { - Array = array; Start = start; Length = length; - } - - public ByteString(string text) + public struct ByteString : IEquatable<ByteString> { - Start = 0; Length = text.Length; - Array = Encoding.ASCII.GetBytes(text); - } - - public override int GetHashCode() - { - if (Length < 1) return 0; - int hc = Length ^ (Array[Start] << 24); if (Length < 2) return hc; - hc ^= Array[Start+Length-1] << 20; if (Length < 3) return hc; - for (int c = Length-2; c > 0; c--) - hc ^= Array[Start + c] << (c & 0xf); - return hc; - } + public byte[] Array; + public int Start; + public int Length; - public bool Equals(ByteString other) - { - if (Length != other.Length) return false; - for (int i = 0; i < Length; i++) - if (Array[Start+i] != other.Array[other.Start+i]) return false; - return true; - } - - public override string ToString() - { - return Encoding.ASCII.GetString(Array, Start, Length); + public ByteString(byte[] array, int start, int length) + { + Array = array; Start = start; Length = length; + } + + public ByteString(string text) + { + Start = 0; Length = text.Length; + Array = Encoding.ASCII.GetBytes(text); + } + + public override int GetHashCode() + { + if (Length < 1) return 0; + int hc = Length ^ (Array[Start] << 24); if (Length < 2) return hc; + hc ^= Array[Start + Length - 1] << 20; if (Length < 3) return hc; + for (int c = Length - 2; c > 0; c--) + hc ^= Array[Start + c] << (c & 0xf); + return hc; + } + + public bool Equals(ByteString other) + { + if (Length != other.Length) return false; + for (int i = 0; i < Length; i++) + if (Array[Start + i] != other.Array[other.Start + i]) return false; + return true; + } + + public override string ToString() + { + return Encoding.ASCII.GetString(Array, Start, Length); + } } -} -public static class Extensions -{ - public static byte[] GetBytes(this List<string> input) + public static class Extensions { - int count = 0; - for (int i = 0; i < input.Count; i++) count += input[i].Length; - var byteArray = new byte[count]; - count = 0; - for (int i = 0; i < input.Count; i++) + public static byte[] GetBytes(this List<string> input) { - string line = input[i]; - Encoding.ASCII.GetBytes(line, 0, line.Length, byteArray, count); - count += line.Length; + int count = 0; + for (int i = 0; i < input.Count; i++) count += input[i].Length; + var byteArray = new byte[count]; + count = 0; + for (int i = 0; i < input.Count; i++) + { + string line = input[i]; + Encoding.ASCII.GetBytes(line, 0, line.Length, byteArray, count); + count += line.Length; + } + return byteArray; } - return byteArray; } -} -public class program { - - - public static void Main(string[] args) { - string line; - StreamReader source = new StreamReader(Console.OpenStandardInput()); - var input = new List<string>(); - - while ( (line = source.ReadLine() ) != null ) - if (line[0] == '>' && line.Substring(1, 5) == "THREE") - break; - - while ( (line = source.ReadLine()) != null ) { - char c = line[0]; - if (c == '>') break; - if (c != ';') input.Add(line.ToUpper()); - } - - KNucleotide kn = new KNucleotide(input.GetBytes()); - input = null; - for (int f = 1; f < 3; f++) kn.WriteFrequencies(f); - foreach (var seq in - new[] { "GGT", "GGTA", "GGTATT", "GGTATTTTAATT", + public class program + { + + + public static void Main(string[] args) + { + string line; + StreamReader source = new StreamReader(Console.OpenStandardInput()); + var input = new List<string>(); + + while ((line = source.ReadLine()) != null) + if (line[0] == '>' && line.Substring(1, 5) == "THREE") + break; + + while ((line = source.ReadLine()) != null) + { + char c = line[0]; + if (c == '>') break; + if (c != ';') input.Add(line.ToUpper()); + } + + KNucleotide kn = new KNucleotide(input.GetBytes()); + input = null; + for (int f = 1; f < 3; f++) kn.WriteFrequencies(f); + foreach (var seq in + new[] { "GGT", "GGTA", "GGTATT", "GGTATTTTAATT", "GGTATTTTAATTTATAGT"}) - kn.WriteCount(seq); + kn.WriteCount(seq); + } } -} -public class KNucleotide { + public class KNucleotide + { - private class Count { - public int V; - public Count(int v) { V = v; } - } + private class Count + { + public int V; + public Count(int v) { V = v; } + } - private Dictionary<ByteString, Count> frequencies - = new Dictionary<ByteString, Count>(); - private byte[] sequence; - - public KNucleotide(byte[] s) { sequence = s; } - - public void WriteFrequencies(int length) { - GenerateFrequencies(length); - var items = new List<KeyValuePair<ByteString, Count>>(frequencies); - items.Sort(SortByFrequencyAndCode); - double percent = 100.0 / (sequence.Length - length + 1); - foreach (var item in items) - Console.WriteLine("{0} {1:f3}", - item.Key.ToString(), item.Value.V * percent); - Console.WriteLine(); - } + private Dictionary<ByteString, Count> frequencies + = new Dictionary<ByteString, Count>(); + private byte[] sequence; - public void WriteCount(string fragment) { - GenerateFrequencies(fragment.Length); - Count count; - if (!frequencies.TryGetValue(new ByteString(fragment), out count)) - count = new Count(0); - Console.WriteLine("{0}\t{1}", count.V, fragment); - } + public KNucleotide(byte[] s) { sequence = s; } - private void GenerateFrequencies(int length) { - frequencies.Clear(); - for (int frame = 0; frame < length; frame++) - KFrequency(frame, length); - } + public void WriteFrequencies(int length) + { + GenerateFrequencies(length); + var items = new List<KeyValuePair<ByteString, Count>>(frequencies); + items.Sort(SortByFrequencyAndCode); + double percent = 100.0 / (sequence.Length - length + 1); + foreach (var item in items) + Console.WriteLine("{0} {1:f3}", + item.Key.ToString(), item.Value.V * percent); + Console.WriteLine(); + } - private void KFrequency(int frame, int k) { - int n = sequence.Length - k + 1; - for (int i = frame; i < n; i += k) { - var key = new ByteString(sequence, i, k); + public void WriteCount(string fragment) + { + GenerateFrequencies(fragment.Length); Count count; - if (frequencies.TryGetValue(key, out count)) - count.V++; - else - frequencies[key] = new Count(1); + if (!frequencies.TryGetValue(new ByteString(fragment), out count)) + count = new Count(0); + Console.WriteLine("{0}\t{1}", count.V, fragment); } - } - int SortByFrequencyAndCode( - KeyValuePair<ByteString, Count> i0, - KeyValuePair<ByteString, Count> i1) { - int order = i1.Value.V.CompareTo(i0.Value.V); - if (order != 0) return order; - return i0.Key.ToString().CompareTo(i1.Key.ToString()); + private void GenerateFrequencies(int length) + { + frequencies.Clear(); + for (int frame = 0; frame < length; frame++) + KFrequency(frame, length); + } + + private void KFrequency(int frame, int k) + { + int n = sequence.Length - k + 1; + for (int i = frame; i < n; i += k) + { + var key = new ByteString(sequence, i, k); + Count count; + if (frequencies.TryGetValue(key, out count)) + count.V++; + else + frequencies[key] = new Count(1); + } + } + + int SortByFrequencyAndCode( + KeyValuePair<ByteString, Count> i0, + KeyValuePair<ByteString, Count> i1) + { + int order = i1.Value.V.CompareTo(i0.Value.V); + if (order != 0) return order; + return i0.Key.ToString().CompareTo(i1.Key.ToString()); + } } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/mandelbrot/mandelbrot-best.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/mandelbrot/mandelbrot-best.cs index 9e6912a691..1602a5da7c 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/mandelbrot/mandelbrot-best.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/mandelbrot/mandelbrot-best.cs @@ -19,54 +19,57 @@ using System.Threading.Tasks; using System.IO; using System.Runtime.CompilerServices; -public class MandelBrot +namespace BenchmarksGame { - [MethodImpl(MethodImplOptions.AggressiveInlining)] - static byte getByte(double[] Crb, double Ciby, int x, int y) - { - int res=0; - for(int i=0;i<8;i+=2) + public class MandelBrot + { + [MethodImpl(MethodImplOptions.AggressiveInlining)] + static byte getByte(double[] Crb, double Ciby, int x, int y) { - double Crbx=Crb[x+i], Crbx1=Crb[x+i+1]; - double Zr1=Crbx, Zr2=Crbx1; - double Zi1=Ciby, Zi2=Ciby; - - int b=0; - int j=49; - do + int res = 0; + for (int i = 0; i < 8; i += 2) { - double nZr1=Zr1*Zr1-Zi1*Zi1+Crbx; - Zi1=Zr1*Zi1+Zr1*Zi1+Ciby; - Zr1=nZr1; + double Crbx = Crb[x + i], Crbx1 = Crb[x + i + 1]; + double Zr1 = Crbx, Zr2 = Crbx1; + double Zi1 = Ciby, Zi2 = Ciby; - double nZr2=Zr2*Zr2-Zi2*Zi2+Crbx1; - Zi2=Zr2*Zi2+Zr2*Zi2+Ciby; - Zr2=nZr2; + int b = 0; + int j = 49; + do + { + double nZr1 = Zr1 * Zr1 - Zi1 * Zi1 + Crbx; + Zi1 = Zr1 * Zi1 + Zr1 * Zi1 + Ciby; + Zr1 = nZr1; - if(Zr1*Zr1+Zi1*Zi1>4){b|=2;if(b==3)break;} - if(Zr2*Zr2+Zi2*Zi2>4){b|=1;if(b==3)break;} - } while(--j>0); - res=(res<<2)+b; + double nZr2 = Zr2 * Zr2 - Zi2 * Zi2 + Crbx1; + Zi2 = Zr2 * Zi2 + Zr2 * Zi2 + Ciby; + Zr2 = nZr2; + + if (Zr1 * Zr1 + Zi1 * Zi1 > 4) { b |= 2; if (b == 3) break; } + if (Zr2 * Zr2 + Zi2 * Zi2 > 4) { b |= 1; if (b == 3) break; } + } while (--j > 0); + res = (res << 2) + b; + } + return (byte)(res ^ -1); } - return (byte)(res^-1); - } - public static void Main (String[] args) - { - var n = args.Length > 0 ? Int32.Parse(args[0]) : 200; - double invN=2.0/n; - var Crb = new double[n+7]; - for(int i=0;i<n;i++){ Crb[i]=i*invN-1.5; } - int lineLen = (n-1)/8 + 1; - var data = new byte[n*lineLen]; - Parallel.For(0, n, y => + public static void Main(String[] args) { - var Ciby = y*invN-1.0; - var offset = y*lineLen; - for(int x=0; x<lineLen; x++) - data[offset+x] = getByte(Crb, Ciby, x*8, y); - }); - Console.Out.WriteLine("P4\n{0} {0}", n); - Console.OpenStandardOutput().Write(data, 0, data.Length); + var n = args.Length > 0 ? Int32.Parse(args[0]) : 200; + double invN = 2.0 / n; + var Crb = new double[n + 7]; + for (int i = 0; i < n; i++) { Crb[i] = i * invN - 1.5; } + int lineLen = (n - 1) / 8 + 1; + var data = new byte[n * lineLen]; + Parallel.For(0, n, y => + { + var Ciby = y * invN - 1.0; + var offset = y * lineLen; + for (int x = 0; x < lineLen; x++) + data[offset + x] = getByte(Crb, Ciby, x * 8, y); + }); + Console.Out.WriteLine("P4\n{0} {0}", n); + Console.OpenStandardOutput().Write(data, 0, data.Length); + } } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/mandelbrot/mandelbrot-serial.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/mandelbrot/mandelbrot-serial.cs index 66748b3751..2542ecf0e0 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/mandelbrot/mandelbrot-serial.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/mandelbrot/mandelbrot-serial.cs @@ -15,52 +15,62 @@ using System; using System.IO; -class Mandelbrot { +namespace BenchmarksGame +{ + class Mandelbrot + { - public static void Main(String[] args) { + public static void Main(String[] args) + { - int width = 100; - if (args.Length > 0) - width = Int32.Parse(args[0]); + int width = 100; + if (args.Length > 0) + width = Int32.Parse(args[0]); - int height = width; - int maxiter = 50; - double limit = 4.0; + int height = width; + int maxiter = 50; + double limit = 4.0; - Console.WriteLine("P4"); - Console.WriteLine("{0} {1}", width,height); - Stream s = Console.OpenStandardOutput(1024); + Console.WriteLine("P4"); + Console.WriteLine("{0} {1}", width, height); + Stream s = Console.OpenStandardOutput(1024); - for (int y = 0; y < height; y++) { - int bits = 0; - int xcounter = 0; - double Ci = 2.0*y/height - 1.0; + for (int y = 0; y < height; y++) + { + int bits = 0; + int xcounter = 0; + double Ci = 2.0 * y / height - 1.0; - for (int x = 0; x < width; x++){ - double Zr = 0.0; - double Zi = 0.0; - double Cr = 2.0*x/width - 1.5; - int i = maxiter; + for (int x = 0; x < width; x++) + { + double Zr = 0.0; + double Zi = 0.0; + double Cr = 2.0 * x / width - 1.5; + int i = maxiter; - bits = bits << 1; - do { - double Tr = Zr*Zr - Zi*Zi + Cr; - Zi = 2.0*Zr*Zi + Ci; - Zr = Tr; - if (Zr*Zr + Zi*Zi > limit) { - bits |= 1; - break; - } - } while (--i > 0); + bits = bits << 1; + do + { + double Tr = Zr * Zr - Zi * Zi + Cr; + Zi = 2.0 * Zr * Zi + Ci; + Zr = Tr; + if (Zr * Zr + Zi * Zi > limit) + { + bits |= 1; + break; + } + } while (--i > 0); - if (++xcounter == 8) { - s.WriteByte((byte) (bits ^ 0xff)); - bits = 0; - xcounter = 0; + if (++xcounter == 8) + { + s.WriteByte((byte)(bits ^ 0xff)); + bits = 0; + xcounter = 0; + } + } + if (xcounter != 0) + s.WriteByte((byte)((bits << (8 - xcounter)) ^ 0xff)); } - } - if (xcounter != 0) - s.WriteByte((byte) ((bits << (8 - xcounter)) ^ 0xff)); - } - } + } + } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/n-body/n-body-best.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/n-body/n-body-best.cs index 2d5ec96ee6..e0692a8cb3 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/n-body/n-body-best.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/n-body/n-body-best.cs @@ -15,29 +15,35 @@ using System; -class NBody { - public static void Main(String[] args) { - int n = args.Length > 0 ? Int32.Parse(args[0]) : 10000; - NBodySystem bodies = new NBodySystem(); - Console.WriteLine("{0:f9}", bodies.Energy()); - for (int i = 0; i < n; i++) bodies.Advance(0.01); - Console.WriteLine("{0:f9}", bodies.Energy()); +namespace BenchmarksGame +{ + class NBody + { + public static void Main(String[] args) + { + int n = args.Length > 0 ? Int32.Parse(args[0]) : 10000; + NBodySystem bodies = new NBodySystem(); + Console.WriteLine("{0:f9}", bodies.Energy()); + for (int i = 0; i < n; i++) bodies.Advance(0.01); + Console.WriteLine("{0:f9}", bodies.Energy()); + } } -} -class Body { public double x, y, z, vx, vy, vz, mass; } -class Pair { public Body bi, bj; } + class Body { public double x, y, z, vx, vy, vz, mass; } + class Pair { public Body bi, bj; } -class NBodySystem { - private Body[] bodies; - private Pair[] pairs; + class NBodySystem + { + private Body[] bodies; + private Pair[] pairs; - const double Pi = 3.141592653589793; - const double Solarmass = 4 * Pi * Pi; - const double DaysPeryear = 365.24; + const double Pi = 3.141592653589793; + const double Solarmass = 4 * Pi * Pi; + const double DaysPeryear = 365.24; - public NBodySystem() { - bodies = new Body[] { + public NBodySystem() + { + bodies = new Body[] { new Body() { // Sun mass = Solarmass, }, @@ -78,47 +84,55 @@ class NBodySystem { mass = 5.15138902046611451e-05 * Solarmass, }, }; - - pairs = new Pair[bodies.Length * (bodies.Length-1)/2]; - int pi = 0; - for (int i = 0; i < bodies.Length-1; i++) - for (int j = i+1; j < bodies.Length; j++) - pairs[pi++] = new Pair() { bi = bodies[i], bj = bodies[j] }; - double px = 0.0, py = 0.0, pz = 0.0; - foreach (var b in bodies) { - px += b.vx * b.mass; py += b.vy * b.mass; pz += b.vz * b.mass; - } - var sol = bodies[0]; - sol.vx = -px/Solarmass; sol.vy = -py/Solarmass; sol.vz = -pz/Solarmass; - } + pairs = new Pair[bodies.Length * (bodies.Length - 1) / 2]; + int pi = 0; + for (int i = 0; i < bodies.Length - 1; i++) + for (int j = i + 1; j < bodies.Length; j++) + pairs[pi++] = new Pair() { bi = bodies[i], bj = bodies[j] }; - public void Advance(double dt) { - foreach (var p in pairs) { - Body bi = p.bi, bj = p.bj; - double dx = bi.x - bj.x, dy = bi.y - bj.y, dz = bi.z - bj.z; - double d2 = dx * dx + dy * dy + dz * dz; - double mag = dt / (d2 * Math.Sqrt(d2)); - bi.vx -= dx * bj.mass * mag; bj.vx += dx * bi.mass * mag; - bi.vy -= dy * bj.mass * mag; bj.vy += dy * bi.mass * mag; - bi.vz -= dz * bj.mass * mag; bj.vz += dz * bi.mass * mag; - } - foreach (var b in bodies) { - b.x += dt * b.vx; b.y += dt * b.vy; b.z += dt * b.vz; + double px = 0.0, py = 0.0, pz = 0.0; + foreach (var b in bodies) + { + px += b.vx * b.mass; py += b.vy * b.mass; pz += b.vz * b.mass; + } + var sol = bodies[0]; + sol.vx = -px / Solarmass; sol.vy = -py / Solarmass; sol.vz = -pz / Solarmass; } - } - public double Energy() { - double e = 0.0; - for (int i = 0; i < bodies.Length; i++) { - var bi = bodies[i]; - e += 0.5 * bi.mass * (bi.vx*bi.vx + bi.vy*bi.vy + bi.vz*bi.vz); - for (int j = i+1; j < bodies.Length; j++) { - var bj = bodies[j]; + public void Advance(double dt) + { + foreach (var p in pairs) + { + Body bi = p.bi, bj = p.bj; double dx = bi.x - bj.x, dy = bi.y - bj.y, dz = bi.z - bj.z; - e -= (bi.mass * bj.mass) / Math.Sqrt(dx*dx + dy*dy + dz*dz); + double d2 = dx * dx + dy * dy + dz * dz; + double mag = dt / (d2 * Math.Sqrt(d2)); + bi.vx -= dx * bj.mass * mag; bj.vx += dx * bi.mass * mag; + bi.vy -= dy * bj.mass * mag; bj.vy += dy * bi.mass * mag; + bi.vz -= dz * bj.mass * mag; bj.vz += dz * bi.mass * mag; + } + foreach (var b in bodies) + { + b.x += dt * b.vx; b.y += dt * b.vy; b.z += dt * b.vz; + } + } + + public double Energy() + { + double e = 0.0; + for (int i = 0; i < bodies.Length; i++) + { + var bi = bodies[i]; + e += 0.5 * bi.mass * (bi.vx * bi.vx + bi.vy * bi.vy + bi.vz * bi.vz); + for (int j = i + 1; j < bodies.Length; j++) + { + var bj = bodies[j]; + double dx = bi.x - bj.x, dy = bi.y - bj.y, dz = bi.z - bj.z; + e -= (bi.mass * bj.mass) / Math.Sqrt(dx * dx + dy * dy + dz * dz); + } } + return e; } - return e; } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/pidigits/pidigits-best.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/pidigits/pidigits-best.cs index f9078e51be..4bcf75425e 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/pidigits/pidigits-best.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/pidigits/pidigits-best.cs @@ -19,154 +19,168 @@ using System; using System.Text; using System.Runtime.InteropServices; -public class pidigits { - - GmpInteger q = new GmpInteger(), r = new GmpInteger(), s = new GmpInteger(), t = new GmpInteger(); - GmpInteger u = new GmpInteger(), v = new GmpInteger(), w = new GmpInteger(); - - int i; - StringBuilder strBuf = new StringBuilder (40); - int n; - - pidigits (int n) - { - this.n=n; - } - - private void compose_r(int bq, int br, int bs, int bt) - { - u.mul(r, bs); - r.mul(r, bq); - v.mul(t, br); - r.add(r, v); - t.mul(t, bt); - t.add(t, u); - s.mul(s, bt); - u.mul(q, bs); - s.add(s, u); - q.mul(q, bq); - } - - /* Compose matrix with numbers on the left. */ - private void compose_l(int bq, int br, int bs, int bt) - { - r.mul(r, bt); - u.mul(q, br); - r.add(r, u); - u.mul(t, bs); - t.mul(t, bt); - v.mul(s, br); - t.add(t, v); - s.mul(s, bq); - s.add(s, u); - q.mul(q, bq); - } - - /* Extract one digit. */ - private int extract(int j) - { - u.mul(q, j); - u.add(u, r); - v.mul(s, j); - v.add(v, t); - w.div(u, v); - return w.intValue(); - } - - /* Print one digit. Returns 1 for the last digit. */ - private bool prdigit(int y) - { - strBuf.Append(y); - if (++i % 10 == 0 || i == n) { - if (i%10!=0) for (int j=10-(i%10);j>0;j--) { strBuf.Append(" "); } - strBuf.Append("\t:"); - strBuf.Append(i); - Console.WriteLine(strBuf); - strBuf = new StringBuilder(40); - } - return i == n; - } - - /* Generate successive digits of PI. */ - void Run() - { - int k = 1; - i = 0; - q.set(1); - r.set(0); - s.set(0); - t.set(1); - for (;;) { - int y = extract(3); - if (y == extract(4)) { - if (prdigit(y)) return; - compose_r(10, -10*y, 0, 1); - } else { - compose_l(k, 4*k+2, 0, 2*k+1); - k++; - } - } - } - - public static void Main(String[] args) { - pidigits m = new pidigits(Int32.Parse (args[0])); - m.Run(); - } -} - -[StructLayout (LayoutKind.Sequential)] -struct mpz_t { - public int _mp_alloc; - public int _mp_size; - public IntPtr ptr; -} - -class GmpInteger { - - // Public methods - - public GmpInteger() { - mpz_init(ref pointer); - } - - public GmpInteger(int value) { - mpz_set_si(ref pointer, value); - } - - public void set(int value) { mpz_set_si(ref pointer, value); } - - public void mul(GmpInteger src, int val) { mpz_mul_si(ref pointer, ref src.pointer, val); } - - public void add(GmpInteger op1, GmpInteger op2) { mpz_add(ref pointer, ref op1.pointer, ref op2.pointer); } - - public void div(GmpInteger op1, GmpInteger op2) { mpz_tdiv_q(ref pointer, ref op1.pointer, ref op2.pointer); } - - public int intValue() { return mpz_get_si(ref pointer); } - - public double doubleValue() { return mpz_get_d(ref pointer); } - - // Non public stuff - - mpz_t pointer; - - [DllImport ("gmp", EntryPoint="__gmpz_init")] - extern static void mpz_init(ref mpz_t value); - - [DllImport ("gmp", EntryPoint="__gmpz_mul_si")] - extern static void mpz_mul_si(ref mpz_t dest, ref mpz_t src, int val); - - [DllImport ("gmp", EntryPoint="__gmpz_add")] - extern static void mpz_add(ref mpz_t dest, ref mpz_t src, ref mpz_t src2); - - [DllImport ("gmp", EntryPoint="__gmpz_tdiv_q")] - extern static void mpz_tdiv_q(ref mpz_t dest, ref mpz_t src, ref mpz_t src2); - - [DllImport ("gmp", EntryPoint="__gmpz_set_si")] - extern static void mpz_set_si(ref mpz_t src, int value); - - [DllImport ("gmp", EntryPoint="__gmpz_get_si")] - extern static int mpz_get_si(ref mpz_t src); - - [DllImport ("gmp", EntryPoint="__gmpz_get_d")] - extern static double mpz_get_d(ref mpz_t src); +namespace BenchmarksGame +{ + public class pidigits + { + + GmpInteger q = new GmpInteger(), r = new GmpInteger(), s = new GmpInteger(), t = new GmpInteger(); + GmpInteger u = new GmpInteger(), v = new GmpInteger(), w = new GmpInteger(); + + int i; + StringBuilder strBuf = new StringBuilder(40); + int n; + + pidigits(int n) + { + this.n = n; + } + + private void compose_r(int bq, int br, int bs, int bt) + { + u.mul(r, bs); + r.mul(r, bq); + v.mul(t, br); + r.add(r, v); + t.mul(t, bt); + t.add(t, u); + s.mul(s, bt); + u.mul(q, bs); + s.add(s, u); + q.mul(q, bq); + } + + /* Compose matrix with numbers on the left. */ + private void compose_l(int bq, int br, int bs, int bt) + { + r.mul(r, bt); + u.mul(q, br); + r.add(r, u); + u.mul(t, bs); + t.mul(t, bt); + v.mul(s, br); + t.add(t, v); + s.mul(s, bq); + s.add(s, u); + q.mul(q, bq); + } + + /* Extract one digit. */ + private int extract(int j) + { + u.mul(q, j); + u.add(u, r); + v.mul(s, j); + v.add(v, t); + w.div(u, v); + return w.intValue(); + } + + /* Print one digit. Returns 1 for the last digit. */ + private bool prdigit(int y) + { + strBuf.Append(y); + if (++i % 10 == 0 || i == n) + { + if (i % 10 != 0) for (int j = 10 - (i % 10); j > 0; j--) { strBuf.Append(" "); } + strBuf.Append("\t:"); + strBuf.Append(i); + Console.WriteLine(strBuf); + strBuf = new StringBuilder(40); + } + return i == n; + } + + /* Generate successive digits of PI. */ + void Run() + { + int k = 1; + i = 0; + q.set(1); + r.set(0); + s.set(0); + t.set(1); + for (; ; ) + { + int y = extract(3); + if (y == extract(4)) + { + if (prdigit(y)) return; + compose_r(10, -10 * y, 0, 1); + } + else + { + compose_l(k, 4 * k + 2, 0, 2 * k + 1); + k++; + } + } + } + + public static void Main(String[] args) + { + pidigits m = new pidigits(Int32.Parse(args[0])); + m.Run(); + } + } + + [StructLayout(LayoutKind.Sequential)] + struct mpz_t + { + public int _mp_alloc; + public int _mp_size; + public IntPtr ptr; + } + + class GmpInteger + { + + // Public methods + + public GmpInteger() + { + mpz_init(ref pointer); + } + + public GmpInteger(int value) + { + mpz_set_si(ref pointer, value); + } + + public void set(int value) { mpz_set_si(ref pointer, value); } + + public void mul(GmpInteger src, int val) { mpz_mul_si(ref pointer, ref src.pointer, val); } + + public void add(GmpInteger op1, GmpInteger op2) { mpz_add(ref pointer, ref op1.pointer, ref op2.pointer); } + + public void div(GmpInteger op1, GmpInteger op2) { mpz_tdiv_q(ref pointer, ref op1.pointer, ref op2.pointer); } + + public int intValue() { return mpz_get_si(ref pointer); } + + public double doubleValue() { return mpz_get_d(ref pointer); } + + // Non public stuff + + mpz_t pointer; + + [DllImport("gmp", EntryPoint = "__gmpz_init")] + extern static void mpz_init(ref mpz_t value); + + [DllImport("gmp", EntryPoint = "__gmpz_mul_si")] + extern static void mpz_mul_si(ref mpz_t dest, ref mpz_t src, int val); + + [DllImport("gmp", EntryPoint = "__gmpz_add")] + extern static void mpz_add(ref mpz_t dest, ref mpz_t src, ref mpz_t src2); + + [DllImport("gmp", EntryPoint = "__gmpz_tdiv_q")] + extern static void mpz_tdiv_q(ref mpz_t dest, ref mpz_t src, ref mpz_t src2); + + [DllImport("gmp", EntryPoint = "__gmpz_set_si")] + extern static void mpz_set_si(ref mpz_t src, int value); + + [DllImport("gmp", EntryPoint = "__gmpz_get_si")] + extern static int mpz_get_si(ref mpz_t src); + + [DllImport("gmp", EntryPoint = "__gmpz_get_d")] + extern static double mpz_get_d(ref mpz_t src); + } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/regex-redux/regex-redux-best.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/regex-redux/regex-redux-best.cs index b945bc31b2..ced28d7d91 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/regex-redux/regex-redux-best.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/regex-redux/regex-redux-best.cs @@ -17,58 +17,61 @@ using System; using System.Threading.Tasks; using System.Text.RegularExpressions; -public static class regexredux +namespace BenchmarksGame { - static Regex regex(string re) + public static class regexredux { - // Not compiled on .Net Core, hence poor benchmark results. - return new Regex(re, RegexOptions.Compiled); - } + static Regex regex(string re) + { + // Not compiled on .Net Core, hence poor benchmark results. + return new Regex(re, RegexOptions.Compiled); + } - static string regexCount(string s, string r) - { - int c = 0; - var m = regex(r).Match(s); - while(m.Success) { c++; m = m.NextMatch(); } - return r + " " + c; - } + static string regexCount(string s, string r) + { + int c = 0; + var m = regex(r).Match(s); + while (m.Success) { c++; m = m.NextMatch(); } + return r + " " + c; + } - public static void Main(string[] args) - { - var sequences = Console.In.ReadToEnd(); - var initialLength = sequences.Length; - sequences = Regex.Replace(sequences, ">.*\n|\n", ""); - - var magicTask = Task.Run(() => + public static void Main(string[] args) { - var newseq = regex("tHa[Nt]").Replace(sequences, "<4>"); - newseq = regex("aND|caN|Ha[DS]|WaS").Replace(newseq, "<3>"); - newseq = regex("a[NSt]|BY").Replace(newseq, "<2>"); - newseq = regex("<[^>]*>").Replace(newseq, "|"); - newseq = regex("\\|[^|][^|]*\\|").Replace(newseq, "-"); - return newseq.Length; - }); + var sequences = Console.In.ReadToEnd(); + var initialLength = sequences.Length; + sequences = Regex.Replace(sequences, ">.*\n|\n", ""); + + var magicTask = Task.Run(() => + { + var newseq = regex("tHa[Nt]").Replace(sequences, "<4>"); + newseq = regex("aND|caN|Ha[DS]|WaS").Replace(newseq, "<3>"); + newseq = regex("a[NSt]|BY").Replace(newseq, "<2>"); + newseq = regex("<[^>]*>").Replace(newseq, "|"); + newseq = regex("\\|[^|][^|]*\\|").Replace(newseq, "-"); + return newseq.Length; + }); - var variant2 = Task.Run(() => regexCount(sequences, "[cgt]gggtaaa|tttaccc[acg]")); - var variant3 = Task.Run(() => regexCount(sequences, "a[act]ggtaaa|tttacc[agt]t")); - var variant7 = Task.Run(() => regexCount(sequences, "agggt[cgt]aa|tt[acg]accct")); - var variant6 = Task.Run(() => regexCount(sequences, "aggg[acg]aaa|ttt[cgt]ccct")); - var variant4 = Task.Run(() => regexCount(sequences, "ag[act]gtaaa|tttac[agt]ct")); - var variant5 = Task.Run(() => regexCount(sequences, "agg[act]taaa|ttta[agt]cct")); - var variant1 = Task.Run(() => regexCount(sequences, "agggtaaa|tttaccct")); - var variant9 = Task.Run(() => regexCount(sequences, "agggtaa[cgt]|[acg]ttaccct")); - var variant8 = Task.Run(() => regexCount(sequences, "agggta[cgt]a|t[acg]taccct")); + var variant2 = Task.Run(() => regexCount(sequences, "[cgt]gggtaaa|tttaccc[acg]")); + var variant3 = Task.Run(() => regexCount(sequences, "a[act]ggtaaa|tttacc[agt]t")); + var variant7 = Task.Run(() => regexCount(sequences, "agggt[cgt]aa|tt[acg]accct")); + var variant6 = Task.Run(() => regexCount(sequences, "aggg[acg]aaa|ttt[cgt]ccct")); + var variant4 = Task.Run(() => regexCount(sequences, "ag[act]gtaaa|tttac[agt]ct")); + var variant5 = Task.Run(() => regexCount(sequences, "agg[act]taaa|ttta[agt]cct")); + var variant1 = Task.Run(() => regexCount(sequences, "agggtaaa|tttaccct")); + var variant9 = Task.Run(() => regexCount(sequences, "agggtaa[cgt]|[acg]ttaccct")); + var variant8 = Task.Run(() => regexCount(sequences, "agggta[cgt]a|t[acg]taccct")); - Console.Out.WriteLineAsync(variant1.Result); - Console.Out.WriteLineAsync(variant2.Result); - Console.Out.WriteLineAsync(variant3.Result); - Console.Out.WriteLineAsync(variant4.Result); - Console.Out.WriteLineAsync(variant5.Result); - Console.Out.WriteLineAsync(variant6.Result); - Console.Out.WriteLineAsync(variant7.Result); - Console.Out.WriteLineAsync(variant8.Result); - Console.Out.WriteLineAsync(variant9.Result); - Console.Out.WriteLineAsync("\n"+initialLength+"\n"+sequences.Length); - Console.Out.WriteLineAsync(magicTask.Result.ToString()); + Console.Out.WriteLineAsync(variant1.Result); + Console.Out.WriteLineAsync(variant2.Result); + Console.Out.WriteLineAsync(variant3.Result); + Console.Out.WriteLineAsync(variant4.Result); + Console.Out.WriteLineAsync(variant5.Result); + Console.Out.WriteLineAsync(variant6.Result); + Console.Out.WriteLineAsync(variant7.Result); + Console.Out.WriteLineAsync(variant8.Result); + Console.Out.WriteLineAsync(variant9.Result); + Console.Out.WriteLineAsync("\n" + initialLength + "\n" + sequences.Length); + Console.Out.WriteLineAsync(magicTask.Result.ToString()); + } } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/regex-redux/regex-redux-serial.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/regex-redux/regex-redux-serial.cs index 12a44b8e29..61f380a8eb 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/regex-redux/regex-redux-serial.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/regex-redux/regex-redux-serial.cs @@ -17,22 +17,25 @@ using System; using System.Text.RegularExpressions; -class regexredux +namespace BenchmarksGame { - static void Main(string[] args){ - - // read FASTA sequence - String sequence = Console.In.ReadToEnd(); - int initialLength = sequence.Length; + class regexredux + { + static void Main(string[] args) + { - // remove FASTA sequence descriptions and new-lines - Regex r = new Regex(">.*\n|\n", RegexOptions.Compiled); - sequence = r.Replace(sequence,""); - int codeLength = sequence.Length; + // read FASTA sequence + String sequence = Console.In.ReadToEnd(); + int initialLength = sequence.Length; + // remove FASTA sequence descriptions and new-lines + Regex r = new Regex(">.*\n|\n", RegexOptions.Compiled); + sequence = r.Replace(sequence, ""); + int codeLength = sequence.Length; - // regex match - string[] variants = { + + // regex match + string[] variants = { "agggtaaa|tttaccct" ,"[cgt]gggtaaa|tttaccc[acg]" ,"a[act]ggtaaa|tttacc[agt]t" @@ -42,44 +45,48 @@ class regexredux ,"agggt[cgt]aa|tt[acg]accct" ,"agggta[cgt]a|t[acg]taccct" ,"agggtaa[cgt]|[acg]ttaccct" - }; + }; - int count; - foreach (string v in variants){ - count = 0; - r = new Regex(v, RegexOptions.Compiled); + int count; + foreach (string v in variants) + { + count = 0; + r = new Regex(v, RegexOptions.Compiled); - for (Match m = r.Match(sequence); m.Success; m = m.NextMatch()) count++; - Console.WriteLine("{0} {1}", v, count); - } + for (Match m = r.Match(sequence); m.Success; m = m.NextMatch()) count++; + Console.WriteLine("{0} {1}", v, count); + } - // regex substitution - IUB[] codes = { + // regex substitution + IUB[] codes = { new IUB("tHa[Nt]", "<4>") ,new IUB("aND|caN|Ha[DS]|WaS", "<3>") ,new IUB("a[NSt]|BY", "<2>") ,new IUB("<[^>]*>", "|") ,new IUB("\\|[^|][^|]*\\|" , "-") - }; - - foreach (IUB iub in codes) { - r = new Regex(iub.code, RegexOptions.Compiled); - sequence = r.Replace(sequence,iub.alternatives); - } - Console.WriteLine("\n{0}\n{1}\n{2}", - initialLength, codeLength, sequence.Length); - } - - - struct IUB - { - public string code; - public string alternatives; - - public IUB(string code, string alternatives) { - this.code = code; - this.alternatives = alternatives; - } - } + }; + + foreach (IUB iub in codes) + { + r = new Regex(iub.code, RegexOptions.Compiled); + sequence = r.Replace(sequence, iub.alternatives); + } + Console.WriteLine("\n{0}\n{1}\n{2}", + initialLength, codeLength, sequence.Length); + } + + + struct IUB + { + public string code; + public string alternatives; + + public IUB(string code, string alternatives) + { + this.code = code; + this.alternatives = alternatives; + } + } + } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/reverse-complement/reverse-complement-best.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/reverse-complement/reverse-complement-best.cs index 8cd35688ac..6ff7dcc23d 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/reverse-complement/reverse-complement-best.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/reverse-complement/reverse-complement-best.cs @@ -19,199 +19,212 @@ using System.Collections.Generic; using System.Collections.Concurrent; using System.Threading; -class RevCompSequence { public List<byte[]> Pages; public int StartHeader, EndExclusive; public Thread ReverseThread; } - -public static class revcomp +namespace BenchmarksGame { - const int READER_BUFFER_SIZE = 1024 * 1024; - const byte LF = 10, GT = (byte)'>', SP = 32; - static BlockingCollection<byte[]> readQue = new BlockingCollection<byte[]>(); - static BlockingCollection<RevCompSequence> writeQue = new BlockingCollection<RevCompSequence>(); - static byte[] map; - - static int read(Stream stream, byte[] buffer, int offset, int count) - { - var bytesRead = stream.Read(buffer, offset, count); - return bytesRead==count ? offset+count - : bytesRead==0 ? offset - : read(stream, buffer, offset+bytesRead, count-bytesRead); - } - static void Reader() - { - using (var stream = Console.OpenStandardInput()) - { - int bytesRead; - do - { - var buffer = new byte[READER_BUFFER_SIZE]; - bytesRead = read(stream, buffer, 0, READER_BUFFER_SIZE); - readQue.Add(buffer); - } while(bytesRead==READER_BUFFER_SIZE); - readQue.CompleteAdding(); - } - } + class RevCompSequence { public List<byte[]> Pages; public int StartHeader, EndExclusive; public Thread ReverseThread; } - static bool tryTake<T>(BlockingCollection<T> q, out T t) where T : class + public static class revcomp { - t = null; - while(!q.IsCompleted && !q.TryTake(out t)) Thread.SpinWait(0); - return t!=null; - } + const int READER_BUFFER_SIZE = 1024 * 1024; + const byte LF = 10, GT = (byte)'>', SP = 32; + static BlockingCollection<byte[]> readQue = new BlockingCollection<byte[]>(); + static BlockingCollection<RevCompSequence> writeQue = new BlockingCollection<RevCompSequence>(); + static byte[] map; - static void Grouper() - { - // Set up complements map - map = new byte[256]; - for (byte b=0; b<255; b++) map[b]=b; - map[(byte)'A'] = (byte)'T'; - map[(byte)'B'] = (byte)'V'; - map[(byte)'C'] = (byte)'G'; - map[(byte)'D'] = (byte)'H'; - map[(byte)'G'] = (byte)'C'; - map[(byte)'H'] = (byte)'D'; - map[(byte)'K'] = (byte)'M'; - map[(byte)'M'] = (byte)'K'; - map[(byte)'R'] = (byte)'Y'; - map[(byte)'T'] = (byte)'A'; - map[(byte)'V'] = (byte)'B'; - map[(byte)'Y'] = (byte)'R'; - map[(byte)'a'] = (byte)'T'; - map[(byte)'b'] = (byte)'V'; - map[(byte)'c'] = (byte)'G'; - map[(byte)'d'] = (byte)'H'; - map[(byte)'g'] = (byte)'C'; - map[(byte)'h'] = (byte)'D'; - map[(byte)'k'] = (byte)'M'; - map[(byte)'m'] = (byte)'K'; - map[(byte)'r'] = (byte)'Y'; - map[(byte)'t'] = (byte)'A'; - map[(byte)'v'] = (byte)'B'; - map[(byte)'y'] = (byte)'R'; - - var startHeader = 0; - var i = 0; - bool afterFirst = false; - var data = new List<byte[]>(); - byte[] bytes; - while (tryTake(readQue, out bytes)) + static int read(Stream stream, byte[] buffer, int offset, int count) { - data.Add(bytes); - while((i=Array.IndexOf<byte>(bytes, GT, i+1))!=-1) + var bytesRead = stream.Read(buffer, offset, count); + return bytesRead == count ? offset + count + : bytesRead == 0 ? offset + : read(stream, buffer, offset + bytesRead, count - bytesRead); + } + static void Reader() + { + using (var stream = Console.OpenStandardInput()) { - var sequence = new RevCompSequence { Pages = data - , StartHeader = startHeader, EndExclusive = i }; - if(afterFirst) - (sequence.ReverseThread = new Thread(() => Reverse(sequence))).Start(); - else - afterFirst = true; - writeQue.Add(sequence); - startHeader = i; - data = new List<byte[]> { bytes }; + int bytesRead; + do + { + var buffer = new byte[READER_BUFFER_SIZE]; + bytesRead = read(stream, buffer, 0, READER_BUFFER_SIZE); + readQue.Add(buffer); + } while (bytesRead == READER_BUFFER_SIZE); + readQue.CompleteAdding(); } } - i = Array.IndexOf<byte>(data[data.Count-1],0,0); - var lastSequence = new RevCompSequence { Pages = data - , StartHeader = startHeader, EndExclusive = i==-1 ? data[data.Count-1].Length : i }; - Reverse(lastSequence); - writeQue.Add(lastSequence); - writeQue.CompleteAdding(); - } - - static void Reverse(RevCompSequence sequence) - { - var startPageId = 0; - var startBytes = sequence.Pages[0]; - var startIndex = sequence.StartHeader; - // Skip header line - while((startIndex=Array.IndexOf<byte>(startBytes, LF, startIndex))==-1) + static bool tryTake<T>(BlockingCollection<T> q, out T t) where T : class { - startBytes = sequence.Pages[++startPageId]; - startIndex = 0; + t = null; + while (!q.IsCompleted && !q.TryTake(out t)) Thread.SpinWait(0); + return t != null; } - var endPageId = sequence.Pages.Count - 1; - var endIndex = sequence.EndExclusive - 1; - if(endIndex==-1) endIndex = sequence.Pages[--endPageId].Length-1; - var endBytes = sequence.Pages[endPageId]; - - // Swap in place across pages - do + static void Grouper() { - var startByte = startBytes[startIndex]; - if(startByte<SP) + // Set up complements map + map = new byte[256]; + for (byte b = 0; b < 255; b++) map[b] = b; + map[(byte)'A'] = (byte)'T'; + map[(byte)'B'] = (byte)'V'; + map[(byte)'C'] = (byte)'G'; + map[(byte)'D'] = (byte)'H'; + map[(byte)'G'] = (byte)'C'; + map[(byte)'H'] = (byte)'D'; + map[(byte)'K'] = (byte)'M'; + map[(byte)'M'] = (byte)'K'; + map[(byte)'R'] = (byte)'Y'; + map[(byte)'T'] = (byte)'A'; + map[(byte)'V'] = (byte)'B'; + map[(byte)'Y'] = (byte)'R'; + map[(byte)'a'] = (byte)'T'; + map[(byte)'b'] = (byte)'V'; + map[(byte)'c'] = (byte)'G'; + map[(byte)'d'] = (byte)'H'; + map[(byte)'g'] = (byte)'C'; + map[(byte)'h'] = (byte)'D'; + map[(byte)'k'] = (byte)'M'; + map[(byte)'m'] = (byte)'K'; + map[(byte)'r'] = (byte)'Y'; + map[(byte)'t'] = (byte)'A'; + map[(byte)'v'] = (byte)'B'; + map[(byte)'y'] = (byte)'R'; + + var startHeader = 0; + var i = 0; + bool afterFirst = false; + var data = new List<byte[]>(); + byte[] bytes; + while (tryTake(readQue, out bytes)) { - if (++startIndex == startBytes.Length) + data.Add(bytes); + while ((i = Array.IndexOf<byte>(bytes, GT, i + 1)) != -1) { - startBytes = sequence.Pages[++startPageId]; - startIndex = 0; + var sequence = new RevCompSequence + { + Pages = data + , + StartHeader = startHeader, + EndExclusive = i + }; + if (afterFirst) + (sequence.ReverseThread = new Thread(() => Reverse(sequence))).Start(); + else + afterFirst = true; + writeQue.Add(sequence); + startHeader = i; + data = new List<byte[]> { bytes }; } - if (startIndex == endIndex && startPageId == endPageId) break; - startByte = startBytes[startIndex]; } - var endByte = endBytes[endIndex]; - if(endByte<SP) + i = Array.IndexOf<byte>(data[data.Count - 1], 0, 0); + var lastSequence = new RevCompSequence { - if (--endIndex == -1) - { - endBytes = sequence.Pages[--endPageId]; - endIndex = endBytes.Length - 1; - } - if (startIndex == endIndex && startPageId == endPageId) break; - endByte = endBytes[endIndex]; - } + Pages = data + , + StartHeader = startHeader, + EndExclusive = i == -1 ? data[data.Count - 1].Length : i + }; + Reverse(lastSequence); + writeQue.Add(lastSequence); + writeQue.CompleteAdding(); + } - startBytes[startIndex] = map[endByte]; - endBytes[endIndex] = map[startByte]; + static void Reverse(RevCompSequence sequence) + { + var startPageId = 0; + var startBytes = sequence.Pages[0]; + var startIndex = sequence.StartHeader; - if (++startIndex == startBytes.Length) + // Skip header line + while ((startIndex = Array.IndexOf<byte>(startBytes, LF, startIndex)) == -1) { startBytes = sequence.Pages[++startPageId]; startIndex = 0; } - if (--endIndex == -1) - { - endBytes = sequence.Pages[--endPageId]; - endIndex = endBytes.Length - 1; - } - } while (startPageId < endPageId || (startPageId == endPageId && startIndex < endIndex)); - if (startIndex == endIndex) startBytes[startIndex] = map[startBytes[startIndex]]; - } - static void Writer() - { - using (var stream = Console.OpenStandardOutput()) - { - bool first = true; - RevCompSequence sequence; - while (tryTake(writeQue, out sequence)) + var endPageId = sequence.Pages.Count - 1; + var endIndex = sequence.EndExclusive - 1; + if (endIndex == -1) endIndex = sequence.Pages[--endPageId].Length - 1; + var endBytes = sequence.Pages[endPageId]; + + // Swap in place across pages + do { - var startIndex = sequence.StartHeader; - var pages = sequence.Pages; - if(first) + var startByte = startBytes[startIndex]; + if (startByte < SP) { - Reverse(sequence); - first = false; + if (++startIndex == startBytes.Length) + { + startBytes = sequence.Pages[++startPageId]; + startIndex = 0; + } + if (startIndex == endIndex && startPageId == endPageId) break; + startByte = startBytes[startIndex]; } - else + var endByte = endBytes[endIndex]; + if (endByte < SP) { - sequence.ReverseThread?.Join(); + if (--endIndex == -1) + { + endBytes = sequence.Pages[--endPageId]; + endIndex = endBytes.Length - 1; + } + if (startIndex == endIndex && startPageId == endPageId) break; + endByte = endBytes[endIndex]; } - for (int i = 0; i < pages.Count - 1; i++) + + startBytes[startIndex] = map[endByte]; + endBytes[endIndex] = map[startByte]; + + if (++startIndex == startBytes.Length) { - var bytes = pages[i]; - stream.Write(bytes, startIndex, bytes.Length - startIndex); + startBytes = sequence.Pages[++startPageId]; startIndex = 0; } - stream.Write(pages[pages.Count-1], startIndex, sequence.EndExclusive - startIndex); + if (--endIndex == -1) + { + endBytes = sequence.Pages[--endPageId]; + endIndex = endBytes.Length - 1; + } + } while (startPageId < endPageId || (startPageId == endPageId && startIndex < endIndex)); + if (startIndex == endIndex) startBytes[startIndex] = map[startBytes[startIndex]]; + } + + static void Writer() + { + using (var stream = Console.OpenStandardOutput()) + { + bool first = true; + RevCompSequence sequence; + while (tryTake(writeQue, out sequence)) + { + var startIndex = sequence.StartHeader; + var pages = sequence.Pages; + if (first) + { + Reverse(sequence); + first = false; + } + else + { + sequence.ReverseThread?.Join(); + } + for (int i = 0; i < pages.Count - 1; i++) + { + var bytes = pages[i]; + stream.Write(bytes, startIndex, bytes.Length - startIndex); + startIndex = 0; + } + stream.Write(pages[pages.Count - 1], startIndex, sequence.EndExclusive - startIndex); + } } } - } - public static void Main(string[] args) - { - new Thread(Reader).Start(); - new Thread(Grouper).Start(); - Writer(); + public static void Main(string[] args) + { + new Thread(Reader).Start(); + new Thread(Grouper).Start(); + Writer(); + } } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/reverse-complement/reverse-complement-serial.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/reverse-complement/reverse-complement-serial.cs index 5838e2f92b..45236b95e1 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/reverse-complement/reverse-complement-serial.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/reverse-complement/reverse-complement-serial.cs @@ -16,93 +16,115 @@ using System; using System.IO; using System.Collections.Generic; -static class revcomp +namespace BenchmarksGame { - struct Block { - public byte[] Data; public int Count; - public int Read(BinaryReader r) { - Data = r.ReadBytes(16384); Count++; return Data.Length; - } - public Index IndexOf(byte b, int o) { - return new Index { Block = Count, Pos = Array.IndexOf(Data, b, o) }; - } - } + static class revcomp + { + struct Block + { + public byte[] Data; public int Count; + public int Read(BinaryReader r) + { + Data = r.ReadBytes(16384); Count++; return Data.Length; + } + public Index IndexOf(byte b, int o) + { + return new Index { Block = Count, Pos = Array.IndexOf(Data, b, o) }; + } + } - struct Index { - public int Block; public int Pos; - public static readonly Index None = new Index { Block = -1, Pos = -1 }; - public bool InBlock(Block b) { return Block == b.Count; } - } + struct Index + { + public int Block; public int Pos; + public static readonly Index None = new Index { Block = -1, Pos = -1 }; + public bool InBlock(Block b) { return Block == b.Count; } + } - const byte Gt = (byte)'>'; - const byte Lf = (byte)'\n'; + const byte Gt = (byte)'>'; + const byte Lf = (byte)'\n'; - static void Main(string[] args) { - InitComplements(); - var seq = new List<byte[]>(); - var b = new Block { Count = -1 }; - Index line = Index.None, start = Index.None, end = Index.None; - using (var r = new BinaryReader(Console.OpenStandardInput())) { - using (var w = Console.OpenStandardOutput()) { - while (b.Read(r) > 0) { - seq.Add(b.Data); - if (line.Pos < 0) line = b.IndexOf(Gt, 0); - while (line.Pos >= 0) { - if (start.Pos < 0) { - var off = line.InBlock(b) ? line.Pos : 0; - start = b.IndexOf(Lf, off); - if (start.Pos < 0) { - w.Write(b.Data, off, b.Data.Length - off); - seq.Clear(); break; - } - w.Write(b.Data, off, start.Pos + 1 - off); - } - if (end.Pos < 0) { - end = b.IndexOf(Gt, start.InBlock(b) ? start.Pos : 0); - if (end.Pos < 0) break; - } - w.Reverse(start.Pos, end.Pos, seq); - if (seq.Count > 1) seq.RemoveRange(0, seq.Count - 1); - line = end; end = Index.None; start = Index.None; - } + static void Main(string[] args) + { + InitComplements(); + var seq = new List<byte[]>(); + var b = new Block { Count = -1 }; + Index line = Index.None, start = Index.None, end = Index.None; + using (var r = new BinaryReader(Console.OpenStandardInput())) + { + using (var w = Console.OpenStandardOutput()) + { + while (b.Read(r) > 0) + { + seq.Add(b.Data); + if (line.Pos < 0) line = b.IndexOf(Gt, 0); + while (line.Pos >= 0) + { + if (start.Pos < 0) + { + var off = line.InBlock(b) ? line.Pos : 0; + start = b.IndexOf(Lf, off); + if (start.Pos < 0) + { + w.Write(b.Data, off, b.Data.Length - off); + seq.Clear(); break; + } + w.Write(b.Data, off, start.Pos + 1 - off); + } + if (end.Pos < 0) + { + end = b.IndexOf(Gt, start.InBlock(b) ? start.Pos : 0); + if (end.Pos < 0) break; + } + w.Reverse(start.Pos, end.Pos, seq); + if (seq.Count > 1) seq.RemoveRange(0, seq.Count - 1); + line = end; end = Index.None; start = Index.None; + } + } + if (start.Pos >= 0 && end.Pos < 0) + w.Reverse(start.Pos, seq[seq.Count - 1].Length, seq); + } } - if (start.Pos >= 0 && end.Pos < 0) - w.Reverse(start.Pos, seq[seq.Count -1].Length, seq); - } - } - } + } - const string Seq = "ABCDGHKMRTVYabcdghkmrtvy"; - const string Rev = "TVGHCDMKYABRTVGHCDMKYABR"; - static byte[] comp = new byte[256]; + const string Seq = "ABCDGHKMRTVYabcdghkmrtvy"; + const string Rev = "TVGHCDMKYABRTVGHCDMKYABR"; + static byte[] comp = new byte[256]; - static void InitComplements() { - for (byte i = 0; i < 255; i++) comp[i] = i; - for (int i = 0; i < Seq.Length; i++) - comp[(byte)Seq[i]] = (byte)Rev[i]; - comp[Lf] = 0; comp[(byte)' '] = 0; - } + static void InitComplements() + { + for (byte i = 0; i < 255; i++) comp[i] = i; + for (int i = 0; i < Seq.Length; i++) + comp[(byte)Seq[i]] = (byte)Rev[i]; + comp[Lf] = 0; comp[(byte)' '] = 0; + } - const int LineLen = 61; - const int BufSize = LineLen * 269; - static byte[] buf = new byte[BufSize]; + const int LineLen = 61; + const int BufSize = LineLen * 269; + static byte[] buf = new byte[BufSize]; - static void Reverse(this Stream w, int si, int ei, List<byte[]> bl) { - int bi = 0, line = LineLen - 1; - for (int ri = bl.Count-1; ri >= 0; ri--) { - var b = bl[ri]; int off = ri == 0 ? si : 0; - for (int i = (ri == bl.Count-1 ? ei : b.Length)-1; i >= off; i--) { - var c = comp[b[i]]; if (c > 0) buf[bi++] = c; - if (bi == line) { - buf[bi++] = Lf; line += LineLen; - if (bi == BufSize) { - w.Write(buf, 0, BufSize); bi = 0; line = LineLen - 1; - } + static void Reverse(this Stream w, int si, int ei, List<byte[]> bl) + { + int bi = 0, line = LineLen - 1; + for (int ri = bl.Count - 1; ri >= 0; ri--) + { + var b = bl[ri]; int off = ri == 0 ? si : 0; + for (int i = (ri == bl.Count - 1 ? ei : b.Length) - 1; i >= off; i--) + { + var c = comp[b[i]]; if (c > 0) buf[bi++] = c; + if (bi == line) + { + buf[bi++] = Lf; line += LineLen; + if (bi == BufSize) + { + w.Write(buf, 0, BufSize); bi = 0; line = LineLen - 1; + } + } + } + } + if (bi > 0) + { + if (buf[bi - 1] != Lf) buf[bi++] = Lf; w.Write(buf, 0, bi); } - } - } - if (bi > 0) { - if (buf[bi-1] != Lf) buf[bi++] = Lf; w.Write(buf, 0, bi); - } - } + } + } } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/spectralnorm/spectralnorm-best.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/spectralnorm/spectralnorm-best.cs index c82f002147..faa8128e8e 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/spectralnorm/spectralnorm-best.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/spectralnorm/spectralnorm-best.cs @@ -24,7 +24,7 @@ namespace SpectralNorms public static void Main(String[] args) { int n = 100; - if (args.Length > 0) n = Int32.Parse(args[0]); + if (args.Length > 0) n = Int32.Parse(args[0]); Console.WriteLine("{0:f9}", spectralnormGame(n)); } diff --git a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/spectralnorm/spectralnorm-serial.cs b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/spectralnorm/spectralnorm-serial.cs index 4ea25857ee..d33ce48d7a 100644 --- a/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/spectralnorm/spectralnorm-serial.cs +++ b/tests/src/JIT/Performance/CodeQuality/BenchmarksGame/spectralnorm/spectralnorm-serial.cs @@ -14,66 +14,79 @@ using System; -class SpectralNorm +namespace BenchmarksGame { - public static void Main(String[] args) { - int n = 100; - if (args.Length > 0) n = Int32.Parse(args[0]); + class SpectralNorm + { + public static void Main(String[] args) + { + int n = 100; + if (args.Length > 0) n = Int32.Parse(args[0]); - Console.WriteLine("{0:f9}", new SpectralNorm().Approximate(n)); - } + Console.WriteLine("{0:f9}", new SpectralNorm().Approximate(n)); + } - double Approximate(int n) { - // create unit vector - double[] u = new double[n]; - for (int i=0; i<n; i++) u[i] = 1; + double Approximate(int n) + { + // create unit vector + double[] u = new double[n]; + for (int i = 0; i < n; i++) u[i] = 1; - // 20 steps of the power method - double[] v = new double[n]; - for (int i=0; i<n; i++) v[i] = 0; + // 20 steps of the power method + double[] v = new double[n]; + for (int i = 0; i < n; i++) v[i] = 0; - for (int i=0; i<10; i++) { - MultiplyAtAv(n,u,v); - MultiplyAtAv(n,v,u); - } + for (int i = 0; i < 10; i++) + { + MultiplyAtAv(n, u, v); + MultiplyAtAv(n, v, u); + } - // B=AtA A multiplied by A transposed - // v.Bv /(v.v) eigenvalue of v - double vBv = 0, vv = 0; - for (int i=0; i<n; i++) { - vBv += u[i]*v[i]; - vv += v[i]*v[i]; - } + // B=AtA A multiplied by A transposed + // v.Bv /(v.v) eigenvalue of v + double vBv = 0, vv = 0; + for (int i = 0; i < n; i++) + { + vBv += u[i] * v[i]; + vv += v[i] * v[i]; + } - return Math.Sqrt(vBv/vv); - } + return Math.Sqrt(vBv / vv); + } - /* return element i,j of infinite matrix A */ - double A(int i, int j){ - return 1.0/((i+j)*(i+j+1)/2 +i+1); - } + /* return element i,j of infinite matrix A */ + double A(int i, int j) + { + return 1.0 / ((i + j) * (i + j + 1) / 2 + i + 1); + } - /* multiply vector v by matrix A */ - void MultiplyAv(int n, double[] v, double[] Av){ - for (int i=0; i<n; i++){ - Av[i] = 0; - for (int j=0; j<n; j++) Av[i] += A(i,j)*v[j]; - } - } + /* multiply vector v by matrix A */ + void MultiplyAv(int n, double[] v, double[] Av) + { + for (int i = 0; i < n; i++) + { + Av[i] = 0; + for (int j = 0; j < n; j++) Av[i] += A(i, j) * v[j]; + } + } - /* multiply vector v by matrix A transposed */ - void MultiplyAtv(int n, double[] v, double[] Atv){ - for (int i=0;i<n;i++){ - Atv[i] = 0; - for (int j=0; j<n; j++) Atv[i] += A(j,i)*v[j]; - } - } + /* multiply vector v by matrix A transposed */ + void MultiplyAtv(int n, double[] v, double[] Atv) + { + for (int i = 0; i < n; i++) + { + Atv[i] = 0; + for (int j = 0; j < n; j++) Atv[i] += A(j, i) * v[j]; + } + } - /* multiply vector v by matrix A and then by matrix A transposed */ - void MultiplyAtAv(int n, double[] v, double[] AtAv){ - double[] u = new double[n]; - MultiplyAv(n,v,u); - MultiplyAtv(n,u,AtAv); - } + /* multiply vector v by matrix A and then by matrix A transposed */ + void MultiplyAtAv(int n, double[] v, double[] AtAv) + { + double[] u = new double[n]; + MultiplyAv(n, v, u); + MultiplyAtv(n, u, AtAv); + } + } } |